Incidental Mutation 'R1646:Fgfr4'
ID173903
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55165964 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 529 (N529Y)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect probably damaging
Transcript: ENSMUST00000005452
AA Change: N529Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: N529Y

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Ncam2 T G 16: 81,465,706 probably benign Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4255:Fgfr4 UTSW 13 55166251 missense probably damaging 1.00
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTTCTGAGACACACAGCCCAGC -3'
(R):5'- ACCTTCCGAGACTCCAGATACTGC -3'

Sequencing Primer
(F):5'- AGCAGGGTTTCACCCCAG -3'
(R):5'- AAGGAGAGTGGTCCTTCGC -3'
Posted On2014-04-24