Incidental Mutation 'R1646:Ncam2'
ID173911
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission 039682-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1646 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) T to G at 81465706 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000037785] [ENSMUST00000037785] [ENSMUST00000037785] [ENSMUST00000067602] [ENSMUST00000067602] [ENSMUST00000067602] [ENSMUST00000067602]
Predicted Effect probably benign
Transcript: ENSMUST00000037785
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037785
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037785
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037785
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067602
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067602
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067602
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000067602
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232550
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.8%
Validation Efficiency 96% (69/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,462,990 S751T probably damaging Het
Akna T G 4: 63,383,892 I581L probably benign Het
Cacnb4 A G 2: 52,474,900 I117T possibly damaging Het
Capn1 A T 19: 5,997,730 F434L probably benign Het
Cbs T C 17: 31,613,195 T547A probably benign Het
Col6a5 A T 9: 105,862,749 L2557* probably null Het
D17Wsu92e A G 17: 27,793,960 S88P probably damaging Het
D1Ertd622e A T 1: 97,645,806 I178N probably damaging Het
Dach1 A G 14: 98,169,114 S66P unknown Het
Ddx31 T C 2: 28,892,520 V625A probably benign Het
Dmxl1 T G 18: 49,962,261 V2969G probably damaging Het
Eapp T A 12: 54,685,960 K122* probably null Het
Epb41l5 G T 1: 119,550,022 probably benign Het
Fat1 T C 8: 45,018,042 S1628P probably damaging Het
Fgfr2 T A 7: 130,242,644 E37V probably damaging Het
Fgfr4 A T 13: 55,165,964 N529Y probably damaging Het
Fsip2 A T 2: 82,978,517 T1727S probably benign Het
Gak A T 5: 108,602,854 S397T probably damaging Het
Gm6040 T A 8: 20,917,097 I36F possibly damaging Het
Grhl1 A G 12: 24,611,861 D513G possibly damaging Het
Gstt1 T A 10: 75,784,106 D219V possibly damaging Het
Hcfc2 T G 10: 82,701,027 V91G probably damaging Het
Hells A T 19: 38,967,783 I808L probably benign Het
Icmt T A 4: 152,299,715 V110E possibly damaging Het
Iqca C T 1: 90,140,038 V164M probably damaging Het
Klri1 G A 6: 129,703,336 P119S probably benign Het
Krt71 C A 15: 101,738,764 probably null Het
Lpin1 A G 12: 16,573,658 probably null Het
Metap2 T C 10: 93,870,197 H241R probably damaging Het
Myh15 A G 16: 49,195,568 Y1869C probably damaging Het
Myo1h G A 5: 114,317,632 G59E possibly damaging Het
Npat T C 9: 53,555,134 V241A probably benign Het
Npbwr1 C A 1: 5,917,254 V14L probably benign Het
Nup37 T A 10: 88,178,234 V323E possibly damaging Het
Olfr1036 A G 2: 86,075,616 N292S probably damaging Het
Olfr1351 C A 10: 79,017,506 Y61* probably null Het
Olfr483 C T 7: 108,103,591 T94I probably benign Het
Olfr743 A T 14: 50,533,583 Q57L probably benign Het
Pdlim4 A T 11: 54,056,254 L132Q possibly damaging Het
Ptcd3 T C 6: 71,898,395 D201G probably benign Het
Ptk7 A T 17: 46,586,297 F370I probably benign Het
Pus7l T C 15: 94,533,636 N371D probably benign Het
Pzp G A 6: 128,503,555 A589V probably benign Het
Rasef T A 4: 73,734,549 R572W probably damaging Het
Reep5 T C 18: 34,349,659 T166A probably benign Het
Rhov A G 2: 119,271,020 V35A probably damaging Het
Ripk4 C T 16: 97,743,897 G517R probably damaging Het
Rnasel A G 1: 153,755,054 T439A probably damaging Het
Slamf9 A G 1: 172,477,340 T174A probably benign Het
Slc12a9 A G 5: 137,323,149 L414P probably damaging Het
Slf1 G A 13: 77,066,648 R640* probably null Het
Slfn8 G T 11: 83,016,886 P277Q probably damaging Het
Stpg2 T A 3: 139,419,702 probably benign Het
Tm9sf3 A C 19: 41,223,179 N408K possibly damaging Het
Trio A G 15: 27,758,347 V2049A possibly damaging Het
Ttn A T 2: 76,814,733 I11180N probably damaging Het
Ush2a T C 1: 188,415,821 C982R probably damaging Het
Usp36 C T 11: 118,273,566 V207M probably damaging Het
Uvrag T C 7: 99,118,224 T67A probably damaging Het
Vasp G A 7: 19,260,978 probably benign Het
Vmn2r115 T C 17: 23,359,539 F662S probably damaging Het
Vmn2r54 A T 7: 12,632,507 C167S probably damaging Het
Vmn2r71 C A 7: 85,621,268 N547K probably damaging Het
Wasf2 A G 4: 133,176,591 I37V probably benign Het
Wwc2 T C 8: 47,842,902 E1111G unknown Het
Zfp317 A G 9: 19,647,312 Y274C probably damaging Het
Zhx3 T C 2: 160,781,275 Y324C probably damaging Het
Zzef1 T C 11: 72,864,036 probably null Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5526:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCATACCTGGCATCAAAAGTCTGTT -3'
(R):5'- TCGATCATCCACAGAAACTGCTTTCC -3'

Sequencing Primer
(F):5'- CTGTGAATTGTAACCATTTTGTTCC -3'
(R):5'- CTGAGTGGTAGTTTTAATAC -3'
Posted On2014-04-24