Incidental Mutation 'R1648:Postn'
ID174001
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54376101 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 534 (T534A)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably damaging
Transcript: ENSMUST00000073012
AA Change: T534A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: T534A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: T534A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: T534A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: T534A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: T534A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: T534A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: T534A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TAATATGTGGATTCCACCCTGCGCTG -3'
(R):5'- AAGGAAACCACTTTGCCATTCACTGTC -3'

Sequencing Primer
(F):5'- CGCTGTACATGGTTAAGTGAATC -3'
(R):5'- ATTCACTGTCCCTCACCAATCAG -3'
Posted On2014-04-24