Incidental Mutation 'R1648:Cep104'
ID174007
Institutional Source Beutler Lab
Gene Symbol Cep104
Ensembl Gene ENSMUSG00000039523
Gene Namecentrosomal protein 104
Synonyms
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.450) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location153975194-154008732 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 153979096 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030893] [ENSMUST00000047497] [ENSMUST00000133607]
Predicted Effect probably benign
Transcript: ENSMUST00000030893
SMART Domains Protein: ENSMUSP00000030893
Gene: ENSMUSG00000029027

DomainStartEndE-ValueType
CAD 9 81 2.48e-41 SMART
Pfam:DFF40 103 324 9.4e-97 PFAM
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000047497
SMART Domains Protein: ENSMUSP00000040762
Gene: ENSMUSG00000039523

DomainStartEndE-ValueType
coiled coil region 222 249 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
SCOP:d1gw5b_ 523 646 3e-5 SMART
coiled coil region 688 730 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154458
Meta Mutation Damage Score 0.47 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for ciliogenesis and for ciliary tip structural integrity. The mammalian protein contains three amino-terminal hydrophobic domains, two glycosylation sites, four cysteine-rich motifs, and two regions with homology to the glutamate receptor ionotropic, NMDA 1 protein. During ciliogenesis, the encoded protein translocates from the distal tips of the centrioles to the tip of the elongating cilium. Knockdown of the protein in human retinal pigment cells results in severe defects in ciliogenesis with structural deformities at the ciliary tips. Allelic variants of this gene are associated with the autosomal-recessive disorder Joubert syndrome, which is characterized by a distinctive mid-hindbrain and cerebellar malformation, oculomotor apraxia, irregular breathing, developmental delay, and ataxia. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Cep104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02755:Cep104 APN 4 153996959 missense possibly damaging 0.93
IGL02884:Cep104 APN 4 153989862 missense probably damaging 0.96
IGL02928:Cep104 APN 4 153981259 missense probably benign 0.18
IGL03119:Cep104 APN 4 153981724 missense probably damaging 1.00
R0409:Cep104 UTSW 4 153983053 splice site probably benign
R0505:Cep104 UTSW 4 153996304 missense probably benign 0.00
R0600:Cep104 UTSW 4 154006792 missense possibly damaging 0.58
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1208:Cep104 UTSW 4 153985379 missense probably damaging 1.00
R1221:Cep104 UTSW 4 153988445 missense probably benign 0.00
R1338:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1528:Cep104 UTSW 4 153994508 missense probably benign 0.01
R1831:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1832:Cep104 UTSW 4 154002546 missense probably benign 0.30
R1911:Cep104 UTSW 4 154006798 missense possibly damaging 0.74
R1914:Cep104 UTSW 4 153989839 missense possibly damaging 0.79
R2516:Cep104 UTSW 4 153989146 missense probably damaging 1.00
R2910:Cep104 UTSW 4 153995427 splice site probably null
R2911:Cep104 UTSW 4 153995427 splice site probably null
R3751:Cep104 UTSW 4 153981756 missense probably damaging 1.00
R3828:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3829:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R3830:Cep104 UTSW 4 153984943 missense probably damaging 1.00
R4474:Cep104 UTSW 4 153989236 missense possibly damaging 0.47
R4731:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4732:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R4733:Cep104 UTSW 4 153988426 missense probably damaging 1.00
R5306:Cep104 UTSW 4 154006242 missense probably benign 0.02
R5449:Cep104 UTSW 4 153985305 splice site probably null
R5567:Cep104 UTSW 4 154002277 missense possibly damaging 0.64
R5761:Cep104 UTSW 4 153981224 missense possibly damaging 0.63
R5980:Cep104 UTSW 4 153988473 missense probably benign 0.00
X0026:Cep104 UTSW 4 153986885 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTGATACCCATCCCCAGATCCTTC -3'
(R):5'- ACTGGGTCCTCTCAGAAACTCCAAG -3'

Sequencing Primer
(F):5'- GGGACTCCCATTAGGGCATAATC -3'
(R):5'- TCTCAGAAACTCCAAGAGAAAAAATG -3'
Posted On2014-04-24