Incidental Mutation 'R1648:Slc26a5'
ID174009
Institutional Source Beutler Lab
Gene Symbol Slc26a5
Ensembl Gene ENSMUSG00000029015
Gene Namesolute carrier family 26, member 5
SynonymsPres, prestin
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location21810655-21865604 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 21813976 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 590 (K590*)
Ref Sequence ENSEMBL: ENSMUSP00000118029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]
Predicted Effect probably null
Transcript: ENSMUST00000030878
AA Change: K622*
SMART Domains Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: K622*

DomainStartEndE-ValueType
Pfam:Sulfate_transp 80 475 3.3e-109 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Pfam:STAS 526 709 3.3e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115176
AA Change: K585*
SMART Domains Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: K585*

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 106 5.2e-9 PFAM
Pfam:Sulfate_transp 156 434 1.6e-65 PFAM
transmembrane domain 439 461 N/A INTRINSIC
Pfam:STAS 489 672 1.5e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000127975
AA Change: K590*
SMART Domains Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: K590*

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 4.3e-33 PFAM
Pfam:Sulfate_transp 193 440 8.9e-56 PFAM
transmembrane domain 447 469 N/A INTRINSIC
Pfam:STAS 494 677 4.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142888
SMART Domains Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 2.1e-33 PFAM
Pfam:Sulfate_transp 193 441 9.6e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150012
Meta Mutation Damage Score 0.628 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Slc26a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Slc26a5 APN 5 21815736 missense probably damaging 1.00
IGL02486:Slc26a5 APN 5 21846325 missense probably damaging 1.00
IGL02639:Slc26a5 APN 5 21819767 missense probably damaging 1.00
IGL02810:Slc26a5 APN 5 21813383 splice site probably benign
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0089:Slc26a5 UTSW 5 21811344 splice site probably null
R0136:Slc26a5 UTSW 5 21834347 missense probably damaging 1.00
R0212:Slc26a5 UTSW 5 21823549 nonsense probably null
R0522:Slc26a5 UTSW 5 21846345 missense probably damaging 0.96
R0557:Slc26a5 UTSW 5 21819764 missense probably damaging 1.00
R0711:Slc26a5 UTSW 5 21847232 missense probably damaging 1.00
R0959:Slc26a5 UTSW 5 21816961 missense probably benign 0.01
R1214:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R1471:Slc26a5 UTSW 5 21816964 missense probably benign 0.12
R1647:Slc26a5 UTSW 5 21813976 nonsense probably null
R1861:Slc26a5 UTSW 5 21816958 missense possibly damaging 0.93
R1875:Slc26a5 UTSW 5 21815727 missense probably benign 0.03
R2106:Slc26a5 UTSW 5 21823544 missense probably damaging 1.00
R2169:Slc26a5 UTSW 5 21813865 missense probably damaging 1.00
R2219:Slc26a5 UTSW 5 21823478 missense probably damaging 1.00
R2276:Slc26a5 UTSW 5 21823547 missense probably benign 0.39
R2281:Slc26a5 UTSW 5 21831510 missense possibly damaging 0.94
R2325:Slc26a5 UTSW 5 21819694 missense probably damaging 1.00
R4031:Slc26a5 UTSW 5 21847191 missense probably damaging 1.00
R4793:Slc26a5 UTSW 5 21837994 missense probably damaging 1.00
R4941:Slc26a5 UTSW 5 21820386 missense probably damaging 1.00
R5122:Slc26a5 UTSW 5 21847196 missense probably damaging 1.00
R5274:Slc26a5 UTSW 5 21813901 missense possibly damaging 0.74
R5312:Slc26a5 UTSW 5 21847260 missense probably damaging 0.99
R5628:Slc26a5 UTSW 5 21816976 missense probably benign 0.20
R5806:Slc26a5 UTSW 5 21823563 missense probably damaging 1.00
R6227:Slc26a5 UTSW 5 21821097 missense probably damaging 1.00
R6525:Slc26a5 UTSW 5 21820350 missense possibly damaging 0.77
R6609:Slc26a5 UTSW 5 21819719 missense possibly damaging 0.93
R6883:Slc26a5 UTSW 5 21834344 missense probably damaging 1.00
R6974:Slc26a5 UTSW 5 21840572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTGTTCCAGGTGGCACTTAC -3'
(R):5'- ACTTGTGGCCTGTCATGCTGAG -3'

Sequencing Primer
(F):5'- ACCCCGGCCAGAGTTTTC -3'
(R):5'- ctgatgccctcttctgcc -3'
Posted On2014-04-24