Incidental Mutation 'R1648:Fras1'
List |< first << previous [record 21 of 72] next >> last >|
ID174011
Institutional Source Beutler Lab
Gene Symbol Fras1
Ensembl Gene ENSMUSG00000034687
Gene NameFraser extracellular matrix complex subunit 1
Synonymsbl, E130113P14Rik
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location96373955-96784728 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 96726613 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036019]
Predicted Effect probably null
Transcript: ENSMUST00000036019
SMART Domains Protein: ENSMUSP00000043250
Gene: ENSMUSG00000034687

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
VWC 27 86 9.23e-9 SMART
VWC 94 151 9.37e-10 SMART
VWC 158 215 8.61e-9 SMART
VWC 220 277 7.1e-10 SMART
VWC 284 341 7.8e-7 SMART
VWC 365 415 1.93e-1 SMART
FU 408 459 3.33e-1 SMART
FU 461 504 9.12e-8 SMART
EGF_like 466 495 6.67e1 SMART
FU 506 552 6.01e-8 SMART
FU 554 598 2.21e-6 SMART
FU 601 646 1.28e-11 SMART
FU 648 704 4.19e-7 SMART
FU 707 752 9.12e-8 SMART
FU 754 799 1.11e-6 SMART
EGF_like 759 790 7.23e1 SMART
FU 802 851 5.44e-6 SMART
EGF_like 807 842 4.55e1 SMART
FU 853 899 7.4e-8 SMART
FU 902 947 4.78e-2 SMART
FU 951 996 4.52e-12 SMART
EGF_like 956 987 2.75e1 SMART
FU 998 1041 1.38e-7 SMART
FU 1045 1088 9.7e-3 SMART
EGF_like 1057 1096 3.16e1 SMART
Pfam:Cadherin_3 1098 1198 5.2e-12 PFAM
Pfam:Cadherin_3 1167 1309 6.5e-27 PFAM
Pfam:Cadherin_3 1278 1442 7e-24 PFAM
Pfam:Cadherin_3 1411 1560 1.3e-23 PFAM
Pfam:Cadherin_3 1561 1693 6.4e-15 PFAM
Pfam:Cadherin_3 1695 1814 1.1e-10 PFAM
Pfam:Cadherin_3 1780 1940 1.6e-18 PFAM
Pfam:Cadherin_3 1906 2061 2.8e-22 PFAM
Pfam:Cadherin_3 2063 2181 3.3e-18 PFAM
Pfam:Cadherin_3 2172 2295 1.4e-26 PFAM
Pfam:Cadherin_3 2296 2408 2.3e-31 PFAM
Pfam:Cadherin_3 2413 2540 7.9e-23 PFAM
Calx_beta 2544 2648 1.23e-10 SMART
Calx_beta 2661 2772 3.3e-11 SMART
Calx_beta 2787 2892 1.21e-9 SMART
Calx_beta 2907 3009 4.45e-3 SMART
Calx_beta 3027 3131 1.5e-14 SMART
Blast:Calx_beta 3162 3187 1e-5 BLAST
transmembrane domain 3902 3924 N/A INTRINSIC
low complexity region 3927 3935 N/A INTRINSIC
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein that appears to function in the regulation of epidermal-basement membrane adhesion and organogenesis during development. Mutations in this gene cause Fraser syndrome, a multisystem malformation that can include craniofacial, urogenital and respiratory system abnormalities. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Survival is variable on genetic backgrounds. Kidney development is severely affected and syndactyly is common. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Fras1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Fras1 APN 5 96739358 missense possibly damaging 0.55
IGL00507:Fras1 APN 5 96778189 missense probably damaging 1.00
IGL00672:Fras1 APN 5 96759450 splice site probably benign
IGL00772:Fras1 APN 5 96636112 missense probably benign 0.42
IGL00844:Fras1 APN 5 96534853 splice site probably benign
IGL00913:Fras1 APN 5 96695076 missense probably damaging 0.99
IGL00959:Fras1 APN 5 96781281 missense probably damaging 0.96
IGL00966:Fras1 APN 5 96555221 missense probably benign 0.00
IGL01296:Fras1 APN 5 96673698 missense probably null 0.58
IGL01307:Fras1 APN 5 96781692 missense probably benign
IGL01481:Fras1 APN 5 96657241 missense probably damaging 1.00
IGL01525:Fras1 APN 5 96739336 missense probably damaging 0.99
IGL01599:Fras1 APN 5 96709891 missense possibly damaging 0.94
IGL01646:Fras1 APN 5 96758148 missense probably benign 0.29
IGL01795:Fras1 APN 5 96778045 missense probably damaging 1.00
IGL01867:Fras1 APN 5 96588131 missense probably benign
IGL01869:Fras1 APN 5 96708783 splice site probably benign
IGL01923:Fras1 APN 5 96735280 missense probably damaging 1.00
IGL01982:Fras1 APN 5 96739248 missense possibly damaging 0.46
IGL02109:Fras1 APN 5 96700523 missense probably benign
IGL02132:Fras1 APN 5 96781637 nonsense probably null
IGL02171:Fras1 APN 5 96735181 missense probably benign 0.15
IGL02213:Fras1 APN 5 96645871 nonsense probably null
IGL02277:Fras1 APN 5 96588118 missense probably benign 0.00
IGL02507:Fras1 APN 5 96657408 missense possibly damaging 0.95
IGL02589:Fras1 APN 5 96769513 missense probably damaging 1.00
IGL02671:Fras1 APN 5 96728616 missense possibly damaging 0.91
IGL02677:Fras1 APN 5 96545024 missense probably damaging 1.00
IGL02691:Fras1 APN 5 96744705 missense possibly damaging 0.68
IGL02741:Fras1 APN 5 96691371 missense probably benign 0.35
IGL02836:Fras1 APN 5 96534866 missense possibly damaging 0.67
IGL02850:Fras1 APN 5 96778175 missense probably damaging 1.00
IGL02998:Fras1 APN 5 96702181 missense possibly damaging 0.82
IGL03040:Fras1 APN 5 96710101 missense probably benign
IGL03078:Fras1 APN 5 96636135 missense probably damaging 1.00
IGL03096:Fras1 APN 5 96764901 missense probably damaging 1.00
IGL03102:Fras1 APN 5 96726535 missense probably benign 0.11
IGL03183:Fras1 APN 5 96733781 splice site probably benign
IGL03189:Fras1 APN 5 96743071 missense probably benign 0.00
IGL03193:Fras1 APN 5 96778106 missense probably damaging 0.99
IGL03292:Fras1 APN 5 96707491 missense probably damaging 1.00
IGL03328:Fras1 APN 5 96781760 missense probably damaging 0.96
IGL03335:Fras1 APN 5 96733944 splice site probably benign
IGL03394:Fras1 APN 5 96667477 missense probably damaging 0.98
IGL03404:Fras1 APN 5 96728581 missense probably damaging 0.99
baby_ruth UTSW 5 96708758 missense probably benign 0.01
I0000:Fras1 UTSW 5 96740829 missense probably damaging 0.99
R0028:Fras1 UTSW 5 96677316 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0049:Fras1 UTSW 5 96776622 missense probably benign 0.07
R0099:Fras1 UTSW 5 96614917 critical splice donor site probably null
R0109:Fras1 UTSW 5 96710077 missense probably benign 0.01
R0158:Fras1 UTSW 5 96776634 missense possibly damaging 0.83
R0268:Fras1 UTSW 5 96737009 missense probably damaging 0.99
R0305:Fras1 UTSW 5 96596888 missense probably benign
R0352:Fras1 UTSW 5 96726540 missense probably damaging 0.97
R0359:Fras1 UTSW 5 96762590 missense probably damaging 0.98
R0371:Fras1 UTSW 5 96555331 missense possibly damaging 0.90
R0379:Fras1 UTSW 5 96755509 nonsense probably null
R0395:Fras1 UTSW 5 96769653 missense possibly damaging 0.50
R0417:Fras1 UTSW 5 96691372 missense probably benign 0.18
R0454:Fras1 UTSW 5 96762665 missense probably damaging 0.96
R0456:Fras1 UTSW 5 96554788 missense probably damaging 1.00
R0456:Fras1 UTSW 5 96714343 splice site probably null
R0464:Fras1 UTSW 5 96636803 missense probably damaging 0.98
R0613:Fras1 UTSW 5 96700488 splice site probably benign
R0652:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R0675:Fras1 UTSW 5 96667387 splice site probably benign
R0765:Fras1 UTSW 5 96552796 missense probably benign 0.00
R0783:Fras1 UTSW 5 96768430 missense probably damaging 1.00
R0811:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0812:Fras1 UTSW 5 96752998 missense probably benign 0.35
R0943:Fras1 UTSW 5 96726543 missense probably benign 0.00
R1037:Fras1 UTSW 5 96714463 missense probably damaging 0.97
R1104:Fras1 UTSW 5 96708671 missense probably benign 0.00
R1108:Fras1 UTSW 5 96642629 missense probably damaging 0.99
R1332:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1336:Fras1 UTSW 5 96707308 missense probably benign 0.00
R1458:Fras1 UTSW 5 96600733 missense probably benign 0.00
R1495:Fras1 UTSW 5 96528586 missense possibly damaging 0.49
R1499:Fras1 UTSW 5 96743187 missense probably benign 0.31
R1528:Fras1 UTSW 5 96636819 missense probably damaging 0.99
R1532:Fras1 UTSW 5 96713996 missense probably damaging 1.00
R1556:Fras1 UTSW 5 96743062 missense possibly damaging 0.88
R1625:Fras1 UTSW 5 96709978 missense possibly damaging 0.94
R1625:Fras1 UTSW 5 96713990 missense probably damaging 1.00
R1645:Fras1 UTSW 5 96700586 missense possibly damaging 0.90
R1647:Fras1 UTSW 5 96726613 critical splice donor site probably null
R1661:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1665:Fras1 UTSW 5 96598909 missense probably damaging 1.00
R1682:Fras1 UTSW 5 96645873 missense probably benign 0.00
R1701:Fras1 UTSW 5 96600784 missense probably benign 0.00
R1716:Fras1 UTSW 5 96552725 missense probably benign 0.10
R1718:Fras1 UTSW 5 96554889 splice site probably null
R1800:Fras1 UTSW 5 96709882 missense probably benign
R1806:Fras1 UTSW 5 96713970 splice site probably benign
R1806:Fras1 UTSW 5 96764976 missense possibly damaging 0.88
R1822:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1823:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1824:Fras1 UTSW 5 96770688 missense probably damaging 1.00
R1847:Fras1 UTSW 5 96749423 intron probably null
R1929:Fras1 UTSW 5 96667437 missense probably benign 0.24
R1951:Fras1 UTSW 5 96712383 missense probably benign 0.38
R2093:Fras1 UTSW 5 96781203 missense probably damaging 1.00
R2283:Fras1 UTSW 5 96654305 missense probably benign 0.10
R2884:Fras1 UTSW 5 96700268 missense probably benign 0.07
R2913:Fras1 UTSW 5 96733915 missense probably benign
R2914:Fras1 UTSW 5 96733915 missense probably benign
R3054:Fras1 UTSW 5 96764943 missense probably damaging 0.99
R3117:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3118:Fras1 UTSW 5 96771712 missense probably damaging 1.00
R3691:Fras1 UTSW 5 96781512 missense probably benign 0.02
R3714:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3715:Fras1 UTSW 5 96645970 critical splice donor site probably null
R3801:Fras1 UTSW 5 96733932 missense probably benign 0.26
R3961:Fras1 UTSW 5 96677385 critical splice donor site probably null
R4065:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4066:Fras1 UTSW 5 96770683 missense possibly damaging 0.64
R4076:Fras1 UTSW 5 96743158 missense probably damaging 1.00
R4124:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4127:Fras1 UTSW 5 96770653 missense probably benign 0.05
R4153:Fras1 UTSW 5 96776735 missense probably benign 0.17
R4233:Fras1 UTSW 5 96714376 missense possibly damaging 0.91
R4273:Fras1 UTSW 5 96614904 missense probably benign 0.00
R4355:Fras1 UTSW 5 96700242 missense probably benign
R4401:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4402:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4403:Fras1 UTSW 5 96642620 missense probably damaging 0.97
R4505:Fras1 UTSW 5 96781348 missense probably damaging 1.00
R4548:Fras1 UTSW 5 96709895 missense probably benign 0.00
R4559:Fras1 UTSW 5 96781289 missense probably damaging 1.00
R4629:Fras1 UTSW 5 96776734 missense probably benign 0.00
R4637:Fras1 UTSW 5 96778088 missense probably damaging 1.00
R4678:Fras1 UTSW 5 96700568 missense probably benign 0.13
R4707:Fras1 UTSW 5 96735238 missense probably damaging 0.96
R4735:Fras1 UTSW 5 96588163 missense probably benign 0.00
R4756:Fras1 UTSW 5 96781659 missense probably benign 0.00
R4762:Fras1 UTSW 5 96731618 missense probably benign
R4820:Fras1 UTSW 5 96728653 missense probably benign 0.00
R4847:Fras1 UTSW 5 96544992 missense possibly damaging 0.94
R4857:Fras1 UTSW 5 96778159 missense probably benign 0.00
R4909:Fras1 UTSW 5 96708758 missense probably benign 0.01
R4931:Fras1 UTSW 5 96636840 missense probably benign 0.02
R4938:Fras1 UTSW 5 96776724 missense probably damaging 0.99
R4952:Fras1 UTSW 5 96647498 missense probably benign 0.01
R4965:Fras1 UTSW 5 96726580 missense possibly damaging 0.95
R4989:Fras1 UTSW 5 96650682 missense possibly damaging 0.75
R5151:Fras1 UTSW 5 96645110 missense probably damaging 1.00
R5168:Fras1 UTSW 5 96708757 missense probably benign 0.00
R5182:Fras1 UTSW 5 96636173 nonsense probably null
R5214:Fras1 UTSW 5 96769593 missense probably damaging 1.00
R5220:Fras1 UTSW 5 96768363 missense probably damaging 1.00
R5235:Fras1 UTSW 5 96600750 missense probably benign 0.02
R5242:Fras1 UTSW 5 96657250 missense probably benign 0.11
R5253:Fras1 UTSW 5 96741025 missense probably damaging 0.99
R5260:Fras1 UTSW 5 96735187 missense possibly damaging 0.79
R5301:Fras1 UTSW 5 96657266 missense possibly damaging 0.88
R5411:Fras1 UTSW 5 96645160 missense probably benign 0.00
R5467:Fras1 UTSW 5 96780053 missense probably benign 0.04
R5543:Fras1 UTSW 5 96528535 missense probably benign 0.01
R5555:Fras1 UTSW 5 96677377 missense probably benign 0.34
R5602:Fras1 UTSW 5 96737021 missense probably damaging 1.00
R5664:Fras1 UTSW 5 96728535 missense possibly damaging 0.91
R5695:Fras1 UTSW 5 96781344 missense probably damaging 1.00
R5717:Fras1 UTSW 5 96781737 missense possibly damaging 0.93
R5742:Fras1 UTSW 5 96768381 missense possibly damaging 0.50
R5759:Fras1 UTSW 5 96709916 missense probably benign 0.02
R5766:Fras1 UTSW 5 96731689 missense possibly damaging 0.91
R5890:Fras1 UTSW 5 96645948 missense probably benign
R6052:Fras1 UTSW 5 96764866 missense probably damaging 1.00
R6058:Fras1 UTSW 5 96709985 missense probably benign
R6256:Fras1 UTSW 5 96733843 missense possibly damaging 0.84
R6306:Fras1 UTSW 5 96764946 missense probably damaging 1.00
R6494:Fras1 UTSW 5 96759564 missense possibly damaging 0.59
R6638:Fras1 UTSW 5 96758094 missense possibly damaging 0.94
R6647:Fras1 UTSW 5 96735202 missense probably damaging 1.00
R6725:Fras1 UTSW 5 96781340 missense possibly damaging 0.91
R6769:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6771:Fras1 UTSW 5 96598941 missense possibly damaging 0.60
R6837:Fras1 UTSW 5 96726973 missense probably damaging 0.99
R6841:Fras1 UTSW 5 96728551 missense probably damaging 0.99
R6863:Fras1 UTSW 5 96543306 missense probably benign 0.19
R6868:Fras1 UTSW 5 96682378 missense probably benign 0.38
R6936:Fras1 UTSW 5 96768352 missense possibly damaging 0.92
Z1088:Fras1 UTSW 5 96743211 missense probably damaging 0.97
Z1088:Fras1 UTSW 5 96758142 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGACAGAGCATCAACCCTGTGTG -3'
(R):5'- AACCCTGACATGAATCTTCTTGGGC -3'

Sequencing Primer
(F):5'- GCATCAACCCTGTGTGTAAGATAG -3'
(R):5'- GCAGGAGATCATGATGGTCTCA -3'
Posted On2014-04-24