Incidental Mutation 'R1648:Olfr642'
ID174027
Institutional Source Beutler Lab
Gene Symbol Olfr642
Ensembl Gene ENSMUSG00000049797
Gene Nameolfactory receptor 642
SynonymsMOR13-6, GA_x6K02T2PBJ9-6784380-6783436
MMRRC Submission 039684-MU
Accession Numbers

Genbank: NM_146329.1

Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location104046529-104052666 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104050169 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 62 (Y62H)
Ref Sequence ENSEMBL: ENSMUSP00000148961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052660] [ENSMUST00000074064] [ENSMUST00000138055] [ENSMUST00000214299]
Predicted Effect probably damaging
Transcript: ENSMUST00000052660
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061462
Gene: ENSMUSG00000049797
AA Change: Y62H

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 8.5e-119 PFAM
Pfam:7TM_GPCR_Srsx 37 309 1.7e-7 PFAM
Pfam:7tm_1 43 294 4.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074064
SMART Domains Protein: ENSMUSP00000073707
Gene: ENSMUSG00000090219

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2.6e-124 PFAM
Pfam:7TM_GPCR_Srsx 37 255 3.1e-7 PFAM
Pfam:7tm_1 43 294 3.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000214299
AA Change: Y62H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0368 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Olfr642
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Olfr642 APN 7 104050169 missense probably damaging 1.00
IGL01933:Olfr642 APN 7 104049814 missense probably damaging 1.00
IGL01980:Olfr642 APN 7 104050093 missense probably benign 0.21
IGL02161:Olfr642 APN 7 104049590 missense possibly damaging 0.66
IGL02639:Olfr642 APN 7 104049781 missense probably damaging 0.99
I2289:Olfr642 UTSW 7 104049754 missense probably damaging 1.00
R0418:Olfr642 UTSW 7 104049772 missense probably benign 0.00
R1647:Olfr642 UTSW 7 104050169 missense probably damaging 1.00
R1701:Olfr642 UTSW 7 104050195 missense possibly damaging 0.95
R2142:Olfr642 UTSW 7 104050300 missense probably damaging 1.00
R2165:Olfr642 UTSW 7 104049638 missense probably benign 0.22
R2655:Olfr642 UTSW 7 104049431 missense probably benign 0.03
R6216:Olfr642 UTSW 7 104049695 missense probably damaging 1.00
R6759:Olfr642 UTSW 7 104050127 missense probably damaging 1.00
R6925:Olfr642 UTSW 7 104049740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AACTGCGGATGATGATGGACATACC -3'
(R):5'- AAGCTTCATGCTGACGGGCTTC -3'

Sequencing Primer
(F):5'- GGTTACAGATAGCCACGTACCG -3'
(R):5'- CTTCCCAGAGATGCAGAGTC -3'
Posted On2014-04-24