Incidental Mutation 'R1648:Atp11a'
List |< first << previous [record 7 of 72] next >> last >|
ID174030
Institutional Source Beutler Lab
Gene Symbol Atp11a
Ensembl Gene ENSMUSG00000031441
Gene NameATPase, class VI, type 11A
SynonymsIh, 4930558F19Rik
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12757014-12868728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12847495 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 270 (S270L)
Ref Sequence ENSEMBL: ENSMUSP00000117091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033818] [ENSMUST00000091237] [ENSMUST00000132974] [ENSMUST00000133338]
Predicted Effect probably damaging
Transcript: ENSMUST00000033818
AA Change: S817L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033818
Gene: ENSMUSG00000031441
AA Change: S817L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 3.6e-26 PFAM
Pfam:E1-E2_ATPase 101 377 1.1e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 9.9e-21 PFAM
Pfam:Cation_ATPase 476 589 2.5e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091237
AA Change: S817L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000088779
Gene: ENSMUSG00000031441
AA Change: S817L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 7.3e-26 PFAM
Pfam:E1-E2_ATPase 101 377 2.7e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 1.9e-20 PFAM
Pfam:Cation_ATPase 476 589 7.4e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 4.5e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132974
AA Change: S270L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117091
Gene: ENSMUSG00000031441
AA Change: S270L

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 42 2.6e-8 PFAM
Pfam:HAD 17 290 4.1e-14 PFAM
Pfam:Hydrolase 20 293 7.7e-13 PFAM
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133338
SMART Domains Protein: ENSMUSP00000120625
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 99 291 7.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136918
Predicted Effect probably benign
Transcript: ENSMUST00000152273
SMART Domains Protein: ENSMUSP00000121989
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_C 1 157 1.7e-43 PFAM
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Atp11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Atp11a APN 8 12844609 missense probably damaging 1.00
IGL01397:Atp11a APN 8 12812321 missense probably damaging 1.00
IGL01712:Atp11a APN 8 12851138 missense probably benign 0.11
IGL02113:Atp11a APN 8 12865048 missense probably benign
IGL02449:Atp11a APN 8 12757358 splice site probably null
IGL02550:Atp11a APN 8 12816997 missense possibly damaging 0.72
IGL03099:Atp11a APN 8 12827462 missense possibly damaging 0.52
R0139:Atp11a UTSW 8 12846054 missense probably benign 0.00
R0265:Atp11a UTSW 8 12856930 splice site probably benign
R0294:Atp11a UTSW 8 12827524 missense probably benign 0.03
R0331:Atp11a UTSW 8 12816953 nonsense probably null
R0582:Atp11a UTSW 8 12831214 missense probably benign 0.10
R1033:Atp11a UTSW 8 12828555 missense probably damaging 1.00
R1213:Atp11a UTSW 8 12842859 missense probably benign 0.04
R1551:Atp11a UTSW 8 12812340 missense probably damaging 1.00
R1752:Atp11a UTSW 8 12813094 missense probably damaging 1.00
R1826:Atp11a UTSW 8 12846154 missense probably damaging 1.00
R1887:Atp11a UTSW 8 12812324 missense probably damaging 1.00
R2079:Atp11a UTSW 8 12857902 missense probably damaging 1.00
R2106:Atp11a UTSW 8 12835228 missense probably benign
R2319:Atp11a UTSW 8 12847505 missense probably damaging 1.00
R2966:Atp11a UTSW 8 12847853 unclassified probably null
R4021:Atp11a UTSW 8 12842938 missense probably benign 0.01
R4183:Atp11a UTSW 8 12816990 missense possibly damaging 0.94
R4640:Atp11a UTSW 8 12828434 splice site probably benign
R4705:Atp11a UTSW 8 12813118 missense probably damaging 1.00
R5354:Atp11a UTSW 8 12806753 missense probably damaging 1.00
R5777:Atp11a UTSW 8 12832522 missense probably damaging 0.99
R6152:Atp11a UTSW 8 12846100 missense probably damaging 0.97
R6171:Atp11a UTSW 8 12832663 missense probably damaging 1.00
R6197:Atp11a UTSW 8 12846099 missense probably benign 0.01
R6335:Atp11a UTSW 8 12859481 critical splice donor site probably null
R6526:Atp11a UTSW 8 12864999 missense probably benign
R6792:Atp11a UTSW 8 12861939 unclassified probably benign
R6923:Atp11a UTSW 8 12856949 missense probably damaging 0.99
R6959:Atp11a UTSW 8 12820467 missense probably damaging 1.00
X0017:Atp11a UTSW 8 12826323 critical splice acceptor site probably null
X0022:Atp11a UTSW 8 12847794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTGGAGGAAATCATCTGAGGGC -3'
(R):5'- AGTCACCAATGTCTGGCTGCAC -3'

Sequencing Primer
(F):5'- GGGCTGTAAGCCAACAATTTC -3'
(R):5'- CCTTCTGTGAAAGATGACCCTGG -3'
Posted On2014-04-24