Incidental Mutation 'R1648:Esr1'
List |< first << previous [record 20 of 72] next >> last >|
ID174037
Institutional Source Beutler Lab
Gene Symbol Esr1
Ensembl Gene ENSMUSG00000019768
Gene Nameestrogen receptor 1 (alpha)
SynonymsERalpha, ERa, ER[a], Estra, Nr3a1, ESR, ER-alpha, Estr
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.859) question?
Stock #R1648 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location4611593-5005614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5001260 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 546 (E546G)
Ref Sequence ENSEMBL: ENSMUSP00000101215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067086] [ENSMUST00000105589] [ENSMUST00000105590]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067086
AA Change: E546G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070070
Gene: ENSMUSG00000019768
AA Change: E546G

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105589
AA Change: E546G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101214
Gene: ENSMUSG00000019768
AA Change: E546G

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 2.3e-64 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105590
AA Change: E546G

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101215
Gene: ENSMUSG00000019768
AA Change: E546G

DomainStartEndE-ValueType
Pfam:Oest_recep 42 185 8.1e-57 PFAM
ZnF_C4 186 257 1.93e-37 SMART
HOLI 352 522 1.23e-35 SMART
Blast:HOLI 523 554 4e-11 BLAST
Pfam:ESR1_C 556 599 1.1e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137012
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: This gene encodes an estrogen receptor, a member of the nuclear hormone family of intracellular receptors. The encoded protein, activated by the sex hormone estrogen, is a transcription factor composed of several domains important for hormone binding, DNA binding, and activation of transcription. Estrogen and its receptors are essential for sexual development and reproductive function, but also play a role in other tissues such as bone. Similar genes in human have been implicated in pathological processes including breast cancer, endometrial cancer, and osteoporosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for targeted null mutations have reduced skeletal growth and are infertile. Females exhibit hypoplastic uteri and nonovulatory ovaries, while males produce few sperm of low motility and fertilizing capacity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Esr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Esr1 APN 10 4997890 missense probably benign 0.00
IGL01886:Esr1 APN 10 4856861 missense probably damaging 0.98
IGL02174:Esr1 APN 10 4998003 missense probably damaging 1.00
IGL02625:Esr1 APN 10 5001346 missense probably benign 0.00
IGL02938:Esr1 APN 10 4783872 missense probably damaging 1.00
IGL03232:Esr1 APN 10 4969270 missense probably damaging 1.00
R0280:Esr1 UTSW 10 4856951 missense probably benign 0.05
R0280:Esr1 UTSW 10 4939289 missense probably damaging 0.99
R0479:Esr1 UTSW 10 4997911 missense probably damaging 1.00
R0943:Esr1 UTSW 10 4746781 missense probably damaging 1.00
R1437:Esr1 UTSW 10 4712571 small deletion probably benign
R1581:Esr1 UTSW 10 4997905 missense probably damaging 1.00
R1644:Esr1 UTSW 10 5001380 missense probably benign 0.00
R1647:Esr1 UTSW 10 5001260 missense possibly damaging 0.76
R1791:Esr1 UTSW 10 4783913 missense probably damaging 1.00
R1955:Esr1 UTSW 10 4857125 missense probably damaging 1.00
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R2870:Esr1 UTSW 10 4997890 missense probably damaging 0.98
R4323:Esr1 UTSW 10 5001307 missense possibly damaging 0.48
R4727:Esr1 UTSW 10 5001418 missense probably benign 0.00
R5009:Esr1 UTSW 10 4712394 missense probably damaging 1.00
R5578:Esr1 UTSW 10 4969164 missense probably damaging 1.00
R5610:Esr1 UTSW 10 5001221 missense probably damaging 1.00
R5836:Esr1 UTSW 10 4712817 missense probably benign 0.02
R5938:Esr1 UTSW 10 4966245 intron probably benign
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6030:Esr1 UTSW 10 4746622 missense possibly damaging 0.93
R6173:Esr1 UTSW 10 4746760 missense probably damaging 1.00
R6575:Esr1 UTSW 10 4966301 intron probably benign
R6888:Esr1 UTSW 10 4857076 missense probably benign 0.00
X0011:Esr1 UTSW 10 4712571 small deletion probably benign
X0018:Esr1 UTSW 10 5001325 missense probably benign
Z1088:Esr1 UTSW 10 4712667 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCAAGTGCCTTTGGAGTTGCTCATC -3'
(R):5'- GGCCACTCATACTAGAAAGCCACTG -3'

Sequencing Primer
(F):5'- TGGAGTTGCTCATCCTCCC -3'
(R):5'- TTGCAGGGATTCTCAGAACC -3'
Posted On2014-04-24