Incidental Mutation 'R1648:Klc1'
List |< first << previous [record 32 of 72] next >> last >|
ID174048
Institutional Source Beutler Lab
Gene Symbol Klc1
Ensembl Gene ENSMUSG00000021288
Gene Namekinesin light chain 1
SynonymsKns2
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location111758849-111807844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111776887 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 216 (L216P)
Ref Sequence ENSEMBL: ENSMUSP00000113997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084941] [ENSMUST00000118471] [ENSMUST00000120544] [ENSMUST00000122300]
Predicted Effect probably damaging
Transcript: ENSMUST00000084941
AA Change: L216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082004
Gene: ENSMUSG00000021288
AA Change: L216P

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.1e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118471
AA Change: L216P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113171
Gene: ENSMUSG00000021288
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 8.3e-69 PFAM
Pfam:TPR_10 212 253 7.2e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120544
AA Change: L216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113237
Gene: ENSMUSG00000021288
AA Change: L216P

DomainStartEndE-ValueType
coiled coil region 86 156 N/A INTRINSIC
low complexity region 158 179 N/A INTRINSIC
low complexity region 188 206 N/A INTRINSIC
Pfam:TPR_10 212 253 3.2e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 4.93e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122300
AA Change: L216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113997
Gene: ENSMUSG00000021288
AA Change: L216P

DomainStartEndE-ValueType
Pfam:Rab5-bind 80 254 1e-68 PFAM
Pfam:TPR_10 212 253 8.4e-9 PFAM
TPR 255 288 3.81e-1 SMART
TPR 297 330 1.16e-5 SMART
TPR 339 372 4.77e-2 SMART
TPR 381 414 2.78e-3 SMART
TPR 464 497 2.99e1 SMART
Meta Mutation Damage Score 0.23 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are significantly smaller than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Klc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Klc1 APN 12 111776884 missense probably damaging 1.00
IGL00940:Klc1 APN 12 111787498 missense probably damaging 1.00
IGL02206:Klc1 APN 12 111778116 unclassified probably benign
IGL02487:Klc1 APN 12 111772452 missense probably damaging 0.99
IGL02490:Klc1 APN 12 111781776 missense possibly damaging 0.89
IGL02830:Klc1 APN 12 111776907 missense probably damaging 0.99
IGL03121:Klc1 APN 12 111781642 unclassified probably benign
IGL03253:Klc1 APN 12 111781644 unclassified probably benign
IGL03376:Klc1 APN 12 111775953 missense probably damaging 0.97
dwarf UTSW 12 111795603 missense probably damaging 1.00
F5770:Klc1 UTSW 12 111774572 missense probably benign 0.09
R0031:Klc1 UTSW 12 111777033 missense probably damaging 0.99
R0239:Klc1 UTSW 12 111785324 splice site probably benign
R1647:Klc1 UTSW 12 111776887 missense probably damaging 1.00
R1892:Klc1 UTSW 12 111781827 critical splice donor site probably null
R2940:Klc1 UTSW 12 111806017 missense possibly damaging 0.49
R4829:Klc1 UTSW 12 111795603 missense probably damaging 1.00
R4849:Klc1 UTSW 12 111781695 missense probably damaging 1.00
R5309:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5312:Klc1 UTSW 12 111795621 missense possibly damaging 0.82
R5637:Klc1 UTSW 12 111774408 missense probably damaging 1.00
R5706:Klc1 UTSW 12 111795627 missense possibly damaging 0.65
R6623:Klc1 UTSW 12 111806041 missense probably damaging 1.00
R6920:Klc1 UTSW 12 111787585 missense probably damaging 1.00
V7580:Klc1 UTSW 12 111774572 missense probably benign 0.09
V7581:Klc1 UTSW 12 111774572 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AGTCAGAGGACCTACCCTTTCTGC -3'
(R):5'- GTACACCAGGGCCAAGATGTTGAG -3'

Sequencing Primer
(F):5'- AGTCCGCAGCACACTGTTC -3'
(R):5'- TTGAGCATGGTAGCCACATC -3'
Posted On2014-04-24