Incidental Mutation 'R1648:Krt7'
List |< first << previous [record 33 of 72] next >> last >|
ID174056
Institutional Source Beutler Lab
Gene Symbol Krt7
Ensembl Gene ENSMUSG00000023039
Gene Namekeratin 7
SynonymsCytokeratin 7, D15Wsu77e, Krt2-7, K7
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1648 (G1)
Quality Score123
Status Not validated
Chromosome15
Chromosomal Location101411043-101430313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101412567 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 32 (S32R)
Ref Sequence ENSEMBL: ENSMUSP00000069900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068904] [ENSMUST00000147662]
Predicted Effect probably damaging
Transcript: ENSMUST00000068904
AA Change: S32R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069900
Gene: ENSMUSG00000023039
AA Change: S32R

DomainStartEndE-ValueType
low complexity region 27 42 N/A INTRINSIC
Pfam:Keratin_2_head 43 81 3.2e-12 PFAM
Filament 84 396 1.95e-174 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141190
Predicted Effect probably benign
Transcript: ENSMUST00000147662
SMART Domains Protein: ENSMUSP00000117046
Gene: ENSMUSG00000023039

DomainStartEndE-ValueType
Pfam:Filament 1 115 4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231016
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation of urothelial cells without histological evidence of hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rps6ka4 C A 19: 6,839,362 V118L probably benign Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Krt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Krt7 APN 15 101427085 unclassified probably benign
IGL01025:Krt7 APN 15 101423421 missense probably benign 0.17
IGL02229:Krt7 APN 15 101427616 missense probably benign 0.09
IGL03366:Krt7 APN 15 101427610 missense possibly damaging 0.87
R0256:Krt7 UTSW 15 101423309 nonsense probably null
R1696:Krt7 UTSW 15 101423426 missense probably benign 0.01
R1779:Krt7 UTSW 15 101423409 missense probably damaging 1.00
R1837:Krt7 UTSW 15 101419582 missense probably benign 0.42
R2045:Krt7 UTSW 15 101423484 unclassified probably null
R2510:Krt7 UTSW 15 101412657 missense probably benign 0.01
R2511:Krt7 UTSW 15 101412657 missense probably benign 0.01
R4041:Krt7 UTSW 15 101423280 unclassified probably null
R4729:Krt7 UTSW 15 101420558 missense probably benign 0.03
R4964:Krt7 UTSW 15 101413972 missense probably damaging 1.00
R5032:Krt7 UTSW 15 101412547 missense probably benign 0.00
R6023:Krt7 UTSW 15 101412397 intron probably benign
R6270:Krt7 UTSW 15 101419558 missense probably damaging 1.00
X0026:Krt7 UTSW 15 101412772 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAAGGTCGCAGACTGCCTGAG -3'
(R):5'- CCGAGACCAGTCAACTATGGAAGC -3'

Sequencing Primer
(F):5'- ACTGCCTGAGGTCAGGGAG -3'
(R):5'- GCCCAAGGCCATTTGTTG -3'
Posted On2014-04-24