Incidental Mutation 'R1648:Rps6ka4'
List |< first << previous [record 54 of 72] next >> last >|
ID174064
Institutional Source Beutler Lab
Gene Symbol Rps6ka4
Ensembl Gene ENSMUSG00000024952
Gene Nameribosomal protein S6 kinase, polypeptide 4
Synonyms1110069D02Rik, MSK2, 90kDa
MMRRC Submission 039684-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R1648 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6829085-6840601 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6839362 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 118 (V118L)
Ref Sequence ENSEMBL: ENSMUSP00000131581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025903] [ENSMUST00000170516]
Predicted Effect probably benign
Transcript: ENSMUST00000025903
AA Change: V118L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000025903
Gene: ENSMUSG00000024952
AA Change: V118L

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170516
AA Change: V118L

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131581
Gene: ENSMUSG00000024952
AA Change: V118L

DomainStartEndE-ValueType
S_TKc 33 301 1.93e-98 SMART
S_TK_X 302 363 5.72e-14 SMART
low complexity region 381 395 N/A INTRINSIC
S_TKc 411 674 1.15e-87 SMART
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.4%
Validation Efficiency 95% (73/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains 2 non-identical kinase catalytic domains and phosphorylates various substrates, including CREB1 and ATF1. The encoded protein can also phosphorylate histone H3 to regulate certain inflammatory genes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: No phenotypic information associated with mutations in this gene have been reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,069,420 N1457D probably benign Het
Adgb A G 10: 10,395,371 F817L probably damaging Het
Akap6 A T 12: 53,142,006 K2068* probably null Het
Alms1 T C 6: 85,678,402 L3310P probably damaging Het
Ankrd27 T A 7: 35,603,853 D219E probably benign Het
Atp10a T C 7: 58,784,827 V283A probably damaging Het
Atp11a C T 8: 12,847,495 S270L probably damaging Het
Casp3 T C 8: 46,638,074 S254P probably benign Het
Cep104 G A 4: 153,979,096 probably null Het
Cep170b C T 12: 112,736,372 T423I probably damaging Het
Cfap58 A G 19: 47,955,405 E348G probably benign Het
Chd6 A G 2: 161,042,058 L89S probably damaging Het
Cyp2a22 T C 7: 26,932,368 S488G probably damaging Het
D130040H23Rik C A 8: 69,302,981 H363Q probably benign Het
Dcaf7 T A 11: 106,051,802 F192I probably damaging Het
Ddx20 T C 3: 105,679,188 I614V probably benign Het
Ehbp1 G A 11: 22,096,000 T558I probably damaging Het
Eif2ak3 T A 6: 70,883,631 V397D possibly damaging Het
Eif2b5 T C 16: 20,502,585 V296A possibly damaging Het
Esr1 A G 10: 5,001,260 E546G possibly damaging Het
Fras1 T A 5: 96,726,613 probably null Het
G930045G22Rik T C 6: 50,846,718 noncoding transcript Het
Gemin5 A T 11: 58,147,979 L568* probably null Het
Gm22697+Rbm27 AGGTCCAGGCCCAGGCCCTGGTCCTGGCCCTGGCCCTGGTCCCGGCCCAGGCCC AGGTCCCGGCCCAGGCCC 18: 42,301,883 probably benign Het
Gpr155 T C 2: 73,364,164 probably null Het
Has1 A G 17: 17,849,985 Y225H probably damaging Het
Hk3 A G 13: 55,014,461 F110S probably damaging Het
Iars A G 13: 49,723,002 K848E possibly damaging Het
Kif17 A G 4: 138,269,895 Y43C probably damaging Het
Kif20b A T 19: 34,936,790 T355S possibly damaging Het
Kif21a T C 15: 90,994,367 T237A probably damaging Het
Klc1 T C 12: 111,776,887 L216P probably damaging Het
Krt7 A C 15: 101,412,567 S32R probably damaging Het
Lama3 A G 18: 12,532,199 D2330G possibly damaging Het
Limch1 T A 5: 66,999,256 S511R probably damaging Het
Luzp2 T A 7: 55,264,270 probably null Het
Macc1 T C 12: 119,446,421 M308T probably benign Het
Mroh9 T G 1: 163,046,056 E510A probably damaging Het
Myo1h G T 5: 114,336,275 L458F probably damaging Het
Neto1 A T 18: 86,500,054 Y528F probably damaging Het
Nlrp9b T A 7: 20,026,544 C187S possibly damaging Het
Nup160 T C 2: 90,710,088 Y854H probably damaging Het
Odc1 T C 12: 17,548,537 probably benign Het
Olfr1436 T A 19: 12,298,659 I158L probably benign Het
Olfr519 A G 7: 108,893,765 I214T probably damaging Het
Olfr642 A G 7: 104,050,169 Y62H probably damaging Het
Plcb2 A T 2: 118,723,780 M64K possibly damaging Het
Plcxd3 A T 15: 4,375,809 I33F probably benign Het
Postn A G 3: 54,376,101 T534A probably damaging Het
Prkd2 T A 7: 16,857,807 F588I possibly damaging Het
Prrg4 C A 2: 104,832,743 A173S probably benign Het
Rinl C T 7: 28,797,632 A519V probably damaging Het
Rpgrip1l A C 8: 91,252,889 V975G probably damaging Het
Rtkn T C 6: 83,135,994 S16P probably damaging Het
Sbspon C A 1: 15,883,759 R99L probably damaging Het
Sdf4 G A 4: 155,999,429 A119T probably damaging Het
Sgpp1 T A 12: 75,716,216 H397L possibly damaging Het
Shc2 T A 10: 79,626,111 M367L probably benign Het
Slc26a5 T A 5: 21,813,976 K590* probably null Het
Slc39a12 T C 2: 14,451,992 V597A probably benign Het
Smcp A T 3: 92,584,481 C20S unknown Het
Tdrd6 A C 17: 43,627,109 V1016G possibly damaging Het
Tmem132c T A 5: 127,463,056 probably benign Het
Tmem170b A T 13: 41,606,262 Q16L probably null Het
Tmem30a A G 9: 79,793,029 F61S probably damaging Het
Tnfsf13b T C 8: 10,031,534 M232T probably damaging Het
Trip11 T A 12: 101,884,392 K853* probably null Het
Tusc3 C A 8: 39,046,567 S64* probably null Het
Vmn2r111 A T 17: 22,569,061 D436E probably benign Het
Zfp607a T C 7: 27,879,068 V521A probably benign Het
Zfp704 A T 3: 9,471,039 S140R probably damaging Het
Other mutations in Rps6ka4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Rps6ka4 APN 19 6831128 missense probably damaging 1.00
IGL01548:Rps6ka4 APN 19 6832323 missense probably benign 0.02
IGL02536:Rps6ka4 APN 19 6832071 missense probably damaging 1.00
IGL02902:Rps6ka4 APN 19 6832255 critical splice donor site probably null
IGL03299:Rps6ka4 APN 19 6832247 splice site probably benign
R0510:Rps6ka4 UTSW 19 6840498 missense probably benign 0.13
R1104:Rps6ka4 UTSW 19 6830996 missense probably damaging 1.00
R1620:Rps6ka4 UTSW 19 6838149 missense probably damaging 1.00
R1647:Rps6ka4 UTSW 19 6839362 missense probably benign 0.15
R1939:Rps6ka4 UTSW 19 6839466 missense probably damaging 1.00
R2370:Rps6ka4 UTSW 19 6830100 missense possibly damaging 0.93
R2412:Rps6ka4 UTSW 19 6829941 makesense probably null
R2571:Rps6ka4 UTSW 19 6838103 missense probably damaging 1.00
R2698:Rps6ka4 UTSW 19 6837352 missense probably benign 0.08
R3427:Rps6ka4 UTSW 19 6837755 critical splice donor site probably null
R3721:Rps6ka4 UTSW 19 6839277 missense possibly damaging 0.73
R3844:Rps6ka4 UTSW 19 6837803 nonsense probably null
R4092:Rps6ka4 UTSW 19 6832255 critical splice donor site probably null
R4169:Rps6ka4 UTSW 19 6831820 missense possibly damaging 0.92
R4677:Rps6ka4 UTSW 19 6839486 missense probably damaging 1.00
R4897:Rps6ka4 UTSW 19 6838099 missense probably benign 0.02
R4975:Rps6ka4 UTSW 19 6840310 unclassified probably null
R5631:Rps6ka4 UTSW 19 6830977 splice site probably benign
R6462:Rps6ka4 UTSW 19 6837589 missense possibly damaging 0.90
R6643:Rps6ka4 UTSW 19 6832363 missense probably damaging 1.00
R6939:Rps6ka4 UTSW 19 6838069 missense probably damaging 1.00
U24488:Rps6ka4 UTSW 19 6832356 missense probably damaging 1.00
X0019:Rps6ka4 UTSW 19 6838140 missense probably damaging 0.97
X0027:Rps6ka4 UTSW 19 6837772 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCATTAGGTTCAGGGCAGTCCCAG -3'
(R):5'- TGCCATGAAGGTGCTACGCAAG -3'

Sequencing Primer
(F):5'- AGTCCCAGGAGAGCAGC -3'
(R):5'- GACACAGGAGCATACCCG -3'
Posted On2014-04-24