Incidental Mutation 'R1649:Nsd2'
ID174081
Institutional Source Beutler Lab
Gene Symbol Nsd2
Ensembl Gene ENSMUSG00000057406
Gene Namenuclear receptor binding SET domain protein 2
Synonyms5830445G22Rik, Whsc1, Whsc1l, C130020C13Rik, 9430010A17Rik, D030027O06Rik, D930023B08Rik
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.594) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location33820725-33897975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33854640 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 264 (V264A)
Ref Sequence ENSEMBL: ENSMUSP00000123460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058096] [ENSMUST00000066854] [ENSMUST00000075812] [ENSMUST00000114397] [ENSMUST00000114399] [ENSMUST00000137191] [ENSMUST00000139845]
Predicted Effect probably damaging
Transcript: ENSMUST00000058096
AA Change: V264A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058940
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 629 643 N/A INTRINSIC
PHD 669 711 1.36e-6 SMART
RING 670 710 1.5e1 SMART
PHD 716 763 6.81e-1 SMART
RING 717 762 5.25e-2 SMART
PHD 833 873 2.35e-10 SMART
PWWP 878 940 2.67e-23 SMART
AWS 1011 1062 3.74e-27 SMART
SET 1063 1186 4.48e-43 SMART
PostSET 1187 1203 7.56e-4 SMART
low complexity region 1215 1236 N/A INTRINSIC
PHD 1241 1284 1.98e-8 SMART
low complexity region 1347 1360 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000066854
AA Change: V264A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067205
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075812
AA Change: V264A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075210
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
PWWP 220 285 3.84e-15 SMART
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
low complexity region 630 644 N/A INTRINSIC
PHD 670 712 1.36e-6 SMART
RING 671 711 1.5e1 SMART
PHD 717 764 6.81e-1 SMART
RING 718 763 5.25e-2 SMART
PHD 834 874 2.35e-10 SMART
PWWP 879 941 2.67e-23 SMART
AWS 1012 1063 3.74e-27 SMART
SET 1064 1187 4.48e-43 SMART
PostSET 1188 1204 7.56e-4 SMART
low complexity region 1216 1237 N/A INTRINSIC
PHD 1242 1285 1.98e-8 SMART
low complexity region 1348 1361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114397
AA Change: V264A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110039
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.7e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114399
AA Change: V264A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110041
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137191
AA Change: V264A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122310
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139845
AA Change: V264A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123460
Gene: ENSMUSG00000057406
AA Change: V264A

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Pfam:PWWP 220 332 4.9e-26 PFAM
low complexity region 397 408 N/A INTRINSIC
HMG 452 522 7.64e-9 SMART
low complexity region 532 545 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141416
AA Change: V245A
SMART Domains Protein: ENSMUSP00000117233
Gene: ENSMUSG00000057406
AA Change: V245A

DomainStartEndE-ValueType
Pfam:PWWP 202 314 1.1e-25 PFAM
low complexity region 379 390 N/A INTRINSIC
HMG 434 504 4.7e-9 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains four domains present in other developmental proteins: a PWWP domain, an HMG box, a SET domain, and a PHD-type zinc finger. It is expressed ubiquitously in early development. Wolf-Hirschhorn syndrome (WHS) is a malformation syndrome associated with a hemizygous deletion of the distal short arm of chromosome 4. This gene maps to the 165 kb WHS critical region and has also been involved in the chromosomal translocation t(4;14)(p16.3;q32.3) in multiple myelomas. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Some transcript variants are nonsense-mediated mRNA (NMD) decay candidates, hence not represented as reference sequences. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display reduced fetal size, failed sternum ossification, cleft palate, atrial and ventricular septal defects, stunted growth and postnatal death. Some heterozygotes show severe growth defects, malocclusion, delayed sternum ossification and hypoplasia of the septum secundum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Nsd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Nsd2 APN 5 33855733 missense probably damaging 1.00
IGL00420:Nsd2 APN 5 33883003 missense possibly damaging 0.82
IGL01343:Nsd2 APN 5 33843578 missense probably damaging 1.00
IGL01403:Nsd2 APN 5 33885378 splice site probably benign
IGL01446:Nsd2 APN 5 33861186 splice site probably benign
IGL01571:Nsd2 APN 5 33864687 missense probably benign 0.32
IGL01862:Nsd2 APN 5 33843736 missense probably null 1.00
IGL02040:Nsd2 APN 5 33867571 splice site probably benign
IGL02528:Nsd2 APN 5 33879051 unclassified probably benign
IGL02553:Nsd2 APN 5 33846198 missense probably damaging 1.00
IGL02799:Nsd2 APN 5 33864788 splice site probably benign
IGL02932:Nsd2 APN 5 33880128 missense probably damaging 1.00
Tennis UTSW 5 33843513 missense probably damaging 1.00
R0136:Nsd2 UTSW 5 33855536 missense possibly damaging 0.89
R0372:Nsd2 UTSW 5 33891551 missense probably damaging 0.98
R0521:Nsd2 UTSW 5 33843338 missense probably damaging 1.00
R0548:Nsd2 UTSW 5 33893538 missense probably damaging 1.00
R0726:Nsd2 UTSW 5 33861028 unclassified probably benign
R1018:Nsd2 UTSW 5 33843241 missense probably damaging 1.00
R1638:Nsd2 UTSW 5 33882120 missense possibly damaging 0.87
R1675:Nsd2 UTSW 5 33861149 missense probably benign 0.04
R1900:Nsd2 UTSW 5 33846169 missense probably benign
R2001:Nsd2 UTSW 5 33843402 missense probably damaging 1.00
R2167:Nsd2 UTSW 5 33882919 missense probably damaging 1.00
R2261:Nsd2 UTSW 5 33885527 missense probably damaging 1.00
R2966:Nsd2 UTSW 5 33846122 missense probably benign 0.01
R3931:Nsd2 UTSW 5 33846117 missense probably benign 0.01
R4429:Nsd2 UTSW 5 33843202 missense probably damaging 1.00
R4596:Nsd2 UTSW 5 33882918 missense probably damaging 1.00
R4958:Nsd2 UTSW 5 33892022 missense probably damaging 1.00
R5346:Nsd2 UTSW 5 33879136 missense possibly damaging 0.94
R5957:Nsd2 UTSW 5 33855603 missense probably damaging 1.00
R6054:Nsd2 UTSW 5 33882161 missense probably damaging 1.00
R6124:Nsd2 UTSW 5 33843266 missense probably benign 0.08
R6302:Nsd2 UTSW 5 33867577 missense possibly damaging 0.93
R6390:Nsd2 UTSW 5 33881181 missense probably damaging 1.00
R6496:Nsd2 UTSW 5 33843513 missense probably damaging 1.00
R6828:Nsd2 UTSW 5 33893568 missense probably damaging 0.98
R6925:Nsd2 UTSW 5 33879110 missense probably damaging 1.00
X0020:Nsd2 UTSW 5 33854757 missense probably damaging 1.00
Z1088:Nsd2 UTSW 5 33855738 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGTGCCCTTCTGCTGAAGTCTTG -3'
(R):5'- AGGTCACACTAAAGGAGCATCTATCACC -3'

Sequencing Primer
(F):5'- GCTGAAGTCTTGTCTTGTCTAAAATC -3'
(R):5'- AGGAGCATCTATCACCTTGATTTTC -3'
Posted On2014-04-24