Incidental Mutation 'R1649:Mboat7'
ID174097
Institutional Source Beutler Lab
Gene Symbol Mboat7
Ensembl Gene ENSMUSG00000035596
Gene Namemembrane bound O-acyltransferase domain containing 7
SynonymsLeng4, mBB1, Lpiat1, 5730589L02Rik
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R1649 (G1)
Quality Score132
Status Not validated
Chromosome7
Chromosomal Location3677789-3693523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3685818 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 237 (V237D)
Ref Sequence ENSEMBL: ENSMUSP00000037107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038608] [ENSMUST00000118710] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]
Predicted Effect probably benign
Transcript: ENSMUST00000038608
AA Change: V237D

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596
AA Change: V237D

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:MBOAT 57 420 2.4e-37 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118710
SMART Domains Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:MBOAT 86 343 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127106
SMART Domains Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128364
SMART Domains Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205644
Predicted Effect probably benign
Transcript: ENSMUST00000206343
Predicted Effect probably benign
Transcript: ENSMUST00000206379
Predicted Effect probably benign
Transcript: ENSMUST00000206571
AA Change: V4D

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit hydrocephaly and most die between 1-3 months of age. Mice homozygous for a knock-out allele exhibit partial lethality with decreased body size, decreased forebrain size, delayed neuronal migrationand reduced neurite outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Mboat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Mboat7 APN 7 3691351 missense probably damaging 1.00
IGL02550:Mboat7 APN 7 3683906 unclassified probably null
R0013:Mboat7 UTSW 7 3683822 missense probably damaging 1.00
R0013:Mboat7 UTSW 7 3683822 missense probably damaging 1.00
R0046:Mboat7 UTSW 7 3683818 missense probably damaging 1.00
R0046:Mboat7 UTSW 7 3683818 missense probably damaging 1.00
R2036:Mboat7 UTSW 7 3685672 critical splice donor site probably null
R2091:Mboat7 UTSW 7 3684011 unclassified probably benign
R3031:Mboat7 UTSW 7 3678688 missense probably benign
R4200:Mboat7 UTSW 7 3685753 missense possibly damaging 0.56
R4382:Mboat7 UTSW 7 3688546 missense possibly damaging 0.53
R5407:Mboat7 UTSW 7 3691381 missense probably damaging 1.00
R6181:Mboat7 UTSW 7 3683885 missense probably benign 0.44
R6785:Mboat7 UTSW 7 3685836 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AATACGCTGCCAACCACTGCTG -3'
(R):5'- ACCTACCTGGATTGGCTGGAACAG -3'

Sequencing Primer
(F):5'- TTCCCTACTAGGGGCAGAG -3'
(R):5'- ATTGGCTGGAACAGCCCTTC -3'
Posted On2014-04-24