Incidental Mutation 'R1649:Cdadc1'
ID174125
Institutional Source Beutler Lab
Gene Symbol Cdadc1
Ensembl Gene ENSMUSG00000021982
Gene Namecytidine and dCMP deaminase domain containing 1
Synonyms2310010M10Rik, NYD-SP15
MMRRC Submission 039685-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59559388-59597959 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59573793 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 423 (T423A)
Ref Sequence ENSEMBL: ENSMUSP00000153357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022555] [ENSMUST00000056997] [ENSMUST00000167100] [ENSMUST00000171683] [ENSMUST00000225595] [ENSMUST00000225839]
Predicted Effect probably damaging
Transcript: ENSMUST00000022555
AA Change: T423A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022555
Gene: ENSMUSG00000021982
AA Change: T423A

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.2e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000056997
AA Change: T423A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052233
Gene: ENSMUSG00000021982
AA Change: T423A

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 73 153 9.8e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 4.6e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167100
AA Change: T423A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128022
Gene: ENSMUSG00000021982
AA Change: T423A

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 4.9e-9 PFAM
Pfam:dCMP_cyt_deam_1 317 446 1.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171683
AA Change: T423A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128064
Gene: ENSMUSG00000021982
AA Change: T423A

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 74 153 1.4e-8 PFAM
Pfam:dCMP_cyt_deam_1 317 446 3e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225595
Predicted Effect probably damaging
Transcript: ENSMUST00000225839
AA Change: T423A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
Btaf1 T A 19: 36,981,722 D707E probably benign Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Cdadc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Cdadc1 APN 14 59581369 missense probably damaging 1.00
IGL01897:Cdadc1 APN 14 59592537 critical splice acceptor site probably null
IGL02648:Cdadc1 APN 14 59586363 missense probably damaging 1.00
IGL02720:Cdadc1 APN 14 59586047 missense probably damaging 1.00
R0254:Cdadc1 UTSW 14 59575907 splice site probably benign
R0470:Cdadc1 UTSW 14 59573841 splice site probably benign
R0554:Cdadc1 UTSW 14 59586452 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1462:Cdadc1 UTSW 14 59575858 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586083 missense probably damaging 1.00
R1540:Cdadc1 UTSW 14 59586092 missense probably damaging 1.00
R1900:Cdadc1 UTSW 14 59586532 missense probably damaging 1.00
R1934:Cdadc1 UTSW 14 59589860 missense possibly damaging 0.91
R1976:Cdadc1 UTSW 14 59573768 missense probably damaging 1.00
R2061:Cdadc1 UTSW 14 59581334 missense probably damaging 1.00
R2136:Cdadc1 UTSW 14 59568044 splice site probably null
R2147:Cdadc1 UTSW 14 59597753 critical splice donor site probably null
R2929:Cdadc1 UTSW 14 59597835 start codon destroyed probably null 0.70
R2991:Cdadc1 UTSW 14 59586072 missense possibly damaging 0.68
R4179:Cdadc1 UTSW 14 59592486 missense probably benign 0.12
R4621:Cdadc1 UTSW 14 59586555 missense probably benign 0.00
R4814:Cdadc1 UTSW 14 59568991 frame shift probably null
R4816:Cdadc1 UTSW 14 59568991 frame shift probably null
R4817:Cdadc1 UTSW 14 59568991 frame shift probably null
R4872:Cdadc1 UTSW 14 59564524 missense probably benign 0.04
R5448:Cdadc1 UTSW 14 59573826 missense possibly damaging 0.94
R5642:Cdadc1 UTSW 14 59589923 missense possibly damaging 0.95
R5732:Cdadc1 UTSW 14 59596911 missense probably damaging 0.99
R6472:Cdadc1 UTSW 14 59586042 missense probably damaging 0.99
R6501:Cdadc1 UTSW 14 59586449 missense probably benign 0.00
X0064:Cdadc1 UTSW 14 59575854 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCACTACTTCACAATGTCCGGCAG -3'
(R):5'- AAGGACCGCCATGCGTTACACTTC -3'

Sequencing Primer
(F):5'- TTTGGCAAACAGGAAGTACAC -3'
(R):5'- AGGCTTACTCACAGTCAGTG -3'
Posted On2014-04-24