Incidental Mutation 'R1649:Btaf1'
ID174143
Institutional Source Beutler Lab
Gene Symbol Btaf1
Ensembl Gene ENSMUSG00000040565
Gene NameB-TFIID TATA-box binding protein associated factor 1
SynonymsE430027O22Rik
MMRRC Submission 039685-MU
Accession Numbers

Genbank: NM_001080706

Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1649 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location36926079-37012752 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36981722 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 707 (D707E)
Ref Sequence ENSEMBL: ENSMUSP00000097093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099494]
Predicted Effect probably benign
Transcript: ENSMUST00000099494
AA Change: D707E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097093
Gene: ENSMUSG00000040565
AA Change: D707E

DomainStartEndE-ValueType
low complexity region 87 98 N/A INTRINSIC
low complexity region 143 152 N/A INTRINSIC
PDB:3OC3|B 276 414 3e-6 PDB
low complexity region 438 454 N/A INTRINSIC
Pfam:DUF3535 585 1051 1.1e-133 PFAM
low complexity region 1099 1110 N/A INTRINSIC
low complexity region 1177 1192 N/A INTRINSIC
DEXDc 1261 1469 3.02e-30 SMART
low complexity region 1630 1641 N/A INTRINSIC
HELICc 1657 1743 2.22e-19 SMART
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 88.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a TAF (TATA box-binding protein-associated factor), which associates with TBP (TATA box-binding protein) to form the B-TFIID complex that is required for transcription initiation of genes by RNA polymerase II. This TAF has DNA-dependent ATPase activity, which drives the dissociation of TBP from DNA, freeing the TBP to associate with other TATA boxes or TATA-less promoters. [provided by RefSeq, Sep 2011]
PHENOTYPE: Embryos homozygous for a gene-trapped allele display growth retardation. Embryos homozygous for an ENU-induced allele show growth retardation, edema, abnormal blood circulation, myocardial trabeculae hypoplasia, and delayed head and brain development. [provided by MGI curators]
Allele List at MGI

All alleles(40) : Gene trapped(40)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430078G23Rik A G 8: 3,389,094 probably benign Het
Akr1a1 T A 4: 116,638,020 I261F probably damaging Het
Aldh1l1 T C 6: 90,564,389 V255A probably benign Het
Ambn T A 5: 88,464,481 M172K probably benign Het
BC034090 T C 1: 155,225,573 H315R possibly damaging Het
C6 T C 15: 4,735,257 L145P possibly damaging Het
Cav3 T A 6: 112,472,246 L75Q probably damaging Het
Cavin2 T A 1: 51,300,780 D205E probably benign Het
Cdadc1 T C 14: 59,573,793 T423A probably damaging Het
Cep120 A T 18: 53,724,576 H272Q probably damaging Het
Chd9 A T 8: 90,932,601 Q63L possibly damaging Het
Clspn T C 4: 126,566,435 probably benign Het
Cramp1l G T 17: 24,983,243 H422N probably damaging Het
Csn1s2b A T 5: 87,819,084 M71L probably benign Het
D630045J12Rik C A 6: 38,181,431 A1104S probably damaging Het
D930048N14Rik A G 11: 51,654,836 probably benign Het
Ern2 G A 7: 122,177,400 P366S probably damaging Het
Gm1527 T C 3: 28,898,731 I60T probably damaging Het
Gse1 T C 8: 120,578,515 probably benign Het
Ildr1 T C 16: 36,708,319 L42P probably damaging Het
Itih2 G A 2: 10,105,735 T515I probably benign Het
Jcad C A 18: 4,673,309 P357Q probably damaging Het
Kitl A G 10: 100,064,114 T94A probably benign Het
Klri1 C T 6: 129,698,241 M185I probably benign Het
Lsamp A T 16: 41,955,298 M171L probably benign Het
Macf1 T G 4: 123,484,053 I1460L probably damaging Het
Map1b C G 13: 99,516,478 V4L probably benign Het
Mboat7 A T 7: 3,685,818 V237D probably benign Het
Mctp2 A T 7: 72,161,258 I656K probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Nipsnap2 T A 5: 129,753,237 I205N probably damaging Het
Nsd2 T C 5: 33,854,640 V264A probably damaging Het
Oacyl C T 18: 65,750,096 T582I probably damaging Het
Olfm1 A T 2: 28,229,267 T333S possibly damaging Het
Olfm4 G A 14: 80,011,982 E180K probably damaging Het
Olfr127 T C 17: 37,904,169 F208L probably benign Het
Olfr1368 A T 13: 21,142,742 L105Q probably damaging Het
Olfr146 T G 9: 39,019,480 Q20H probably benign Het
Parp4 T A 14: 56,590,428 V212E possibly damaging Het
Pcdhb21 T A 18: 37,515,613 N598K probably damaging Het
Piezo2 C A 18: 63,117,672 W452L probably benign Het
Plec C A 15: 76,205,811 A110S possibly damaging Het
Popdc3 T C 10: 45,315,224 Y144H probably damaging Het
Ptgdr T C 14: 44,858,502 H251R probably benign Het
Ptpro T A 6: 137,444,017 Y246* probably null Het
Pyroxd2 T C 19: 42,738,134 D247G probably damaging Het
Robo2 T C 16: 73,899,001 E1418G probably benign Het
Rtp3 T C 9: 110,986,704 T198A probably benign Het
Sec16a A T 2: 26,425,524 V1767D probably damaging Het
Sept14 T C 5: 129,697,755 N119D probably benign Het
Serpina5 A T 12: 104,105,225 T364S possibly damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Sh3bp2 C T 5: 34,559,004 A253V possibly damaging Het
Slc6a5 G T 7: 49,936,262 G443C probably damaging Het
Spag9 T A 11: 94,108,452 probably null Het
Sptbn1 T C 11: 30,137,301 E1033G probably damaging Het
Timm17a T G 1: 135,309,802 Q39P probably damaging Het
Tmem26 A T 10: 68,751,273 T184S probably damaging Het
Tpi1 A T 6: 124,812,928 probably null Het
Tssk5 T C 15: 76,373,803 Y118C possibly damaging Het
Ttll4 T A 1: 74,697,470 L1118Q possibly damaging Het
Ttll5 T A 12: 85,923,014 L691Q probably damaging Het
Vmn1r49 A T 6: 90,072,641 H126Q possibly damaging Het
Zfp518b A T 5: 38,671,881 V927E probably damaging Het
Zfp618 T C 4: 63,095,537 F213S probably damaging Het
Zfp759 T A 13: 67,139,604 N406K probably benign Het
Other mutations in Btaf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Btaf1 APN 19 37009702 missense probably damaging 1.00
IGL00535:Btaf1 APN 19 36997535 missense probably damaging 1.00
IGL00574:Btaf1 APN 19 36969930 missense probably benign 0.00
IGL00969:Btaf1 APN 19 37011252 splice site probably benign
IGL01325:Btaf1 APN 19 37004649 splice site probably benign
IGL01399:Btaf1 APN 19 37000170 nonsense probably null
IGL02024:Btaf1 APN 19 36992426 splice site probably benign
IGL02471:Btaf1 APN 19 37000192 missense probably damaging 0.96
IGL02664:Btaf1 APN 19 36978428 splice site probably benign
IGL02898:Btaf1 APN 19 36969068 missense probably benign
IGL02995:Btaf1 APN 19 36981135 splice site probably benign
IGL03023:Btaf1 APN 19 37010015 missense possibly damaging 0.85
IGL03188:Btaf1 APN 19 36949108 missense possibly damaging 0.91
IGL03353:Btaf1 APN 19 36992500 missense probably damaging 1.00
freudenberg UTSW 19 36988173 critical splice donor site probably null
3-1:Btaf1 UTSW 19 37010078 missense probably damaging 1.00
R0013:Btaf1 UTSW 19 36958373 missense probably benign
R0048:Btaf1 UTSW 19 37003524 missense probably benign 0.01
R0117:Btaf1 UTSW 19 36969968 missense probably benign 0.06
R0207:Btaf1 UTSW 19 37009648 nonsense probably null
R0310:Btaf1 UTSW 19 37004534 missense probably damaging 0.96
R0377:Btaf1 UTSW 19 36989002 missense probably benign
R0419:Btaf1 UTSW 19 36945229 missense probably damaging 0.99
R0440:Btaf1 UTSW 19 36986653 missense probably damaging 0.99
R0532:Btaf1 UTSW 19 36951186 splice site probably benign
R0612:Btaf1 UTSW 19 36969137 missense probably damaging 0.99
R0731:Btaf1 UTSW 19 36997495 splice site probably null
R0780:Btaf1 UTSW 19 36988922 missense probably damaging 0.99
R0919:Btaf1 UTSW 19 36990743 missense probably benign 0.03
R1104:Btaf1 UTSW 19 37004602 missense probably damaging 1.00
R1263:Btaf1 UTSW 19 36956524 missense probably benign 0.10
R1325:Btaf1 UTSW 19 36969162 missense possibly damaging 0.68
R1447:Btaf1 UTSW 19 36992454 missense probably benign 0.00
R1554:Btaf1 UTSW 19 36996598 missense probably benign 0.02
R1715:Btaf1 UTSW 19 36969121 missense probably damaging 0.99
R1733:Btaf1 UTSW 19 36994962 missense probably benign
R1764:Btaf1 UTSW 19 36951118 missense probably benign 0.12
R1874:Btaf1 UTSW 19 36980583 missense probably benign
R1911:Btaf1 UTSW 19 36986630 missense probably benign
R1933:Btaf1 UTSW 19 36972957 missense probably damaging 1.00
R2080:Btaf1 UTSW 19 36951148 missense probably benign 0.09
R2483:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R2510:Btaf1 UTSW 19 37002445 missense probably benign 0.08
R3623:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3624:Btaf1 UTSW 19 36981086 missense probably benign 0.02
R3801:Btaf1 UTSW 19 36986548 missense probably benign
R3801:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3802:Btaf1 UTSW 19 36986548 missense probably benign
R3802:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R3803:Btaf1 UTSW 19 36986548 missense probably benign
R3803:Btaf1 UTSW 19 36988973 missense probably benign 0.00
R4077:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4079:Btaf1 UTSW 19 36986479 missense probably benign 0.00
R4133:Btaf1 UTSW 19 36961738 missense probably benign 0.00
R4673:Btaf1 UTSW 19 36978372 missense probably benign 0.00
R4731:Btaf1 UTSW 19 36981078 missense probably benign 0.03
R4796:Btaf1 UTSW 19 36956428 missense possibly damaging 0.95
R4824:Btaf1 UTSW 19 36981048 missense possibly damaging 0.84
R4835:Btaf1 UTSW 19 37002458 missense probably benign 0.00
R4837:Btaf1 UTSW 19 36966785 missense probably benign
R4925:Btaf1 UTSW 19 37011333 missense probably benign
R4968:Btaf1 UTSW 19 36969951 missense probably null 0.71
R4976:Btaf1 UTSW 19 36986579 missense probably benign
R5001:Btaf1 UTSW 19 36986652 missense possibly damaging 0.90
R5037:Btaf1 UTSW 19 37003531 missense probably damaging 1.00
R5039:Btaf1 UTSW 19 36990762 missense probably benign
R5211:Btaf1 UTSW 19 36996562 missense probably benign 0.32
R5422:Btaf1 UTSW 19 36951107 missense probably benign 0.09
R5429:Btaf1 UTSW 19 36994857 missense possibly damaging 0.58
R5530:Btaf1 UTSW 19 36990775 missense possibly damaging 0.85
R5582:Btaf1 UTSW 19 36988173 critical splice donor site probably null
R5654:Btaf1 UTSW 19 36983615 missense probably benign 0.35
R5744:Btaf1 UTSW 19 37004490 missense probably benign 0.02
R6082:Btaf1 UTSW 19 36983542 missense probably damaging 1.00
R6243:Btaf1 UTSW 19 36981120 missense probably benign 0.02
R6291:Btaf1 UTSW 19 36973008 missense probably benign 0.00
R6502:Btaf1 UTSW 19 36983617 missense probably benign
W0251:Btaf1 UTSW 19 37003504 missense probably damaging 1.00
X0027:Btaf1 UTSW 19 36949096 nonsense probably null
Z1088:Btaf1 UTSW 19 36986618 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- aCCAAAACCAAACCACCTCTTGTCTATT -3'
(R):5'- acagacaAAAACCGGAGCACTGAAA -3'

Sequencing Primer
(F):5'- TCATGAAAGTAAGACGGAAGAAAAG -3'
(R):5'- GCACTGAAAAATGTGCTACCTCATAG -3'
Posted On2014-04-24