Incidental Mutation 'R1616:Myo1b'
ID174215
Institutional Source Beutler Lab
Gene Symbol Myo1b
Ensembl Gene ENSMUSG00000018417
Gene Namemyosin IB
Synonyms
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location51749765-51916071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51776315 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 624 (N624S)
Ref Sequence ENSEMBL: ENSMUSP00000040447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018561] [ENSMUST00000046390] [ENSMUST00000114537] [ENSMUST00000114541]
Predicted Effect probably damaging
Transcript: ENSMUST00000018561
AA Change: N624S

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000018561
Gene: ENSMUSG00000018417
AA Change: N624S

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 4.59e0 SMART
IQ 807 829 7.07e-2 SMART
IQ 836 858 3.3e-2 SMART
Pfam:Myosin_TH1 941 1128 3e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000046390
AA Change: N624S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040447
Gene: ENSMUSG00000018417
AA Change: N624S

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 3.68e0 SMART
IQ 807 829 3.3e-2 SMART
Pfam:Myosin_TH1 911 1107 3.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114537
AA Change: N624S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110184
Gene: ENSMUSG00000018417
AA Change: N624S

DomainStartEndE-ValueType
MYSc 9 702 N/A SMART
IQ 703 725 2.37e-3 SMART
IQ 726 748 2.43e0 SMART
IQ 749 771 5.24e-5 SMART
IQ 778 800 1.6e0 SMART
Pfam:Myosin_TH1 882 1078 1.9e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114541
AA Change: N630S

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110188
Gene: ENSMUSG00000018417
AA Change: N630S

DomainStartEndE-ValueType
MYSc 15 708 N/A SMART
IQ 709 731 2.37e-3 SMART
IQ 732 754 2.43e0 SMART
IQ 755 777 5.24e-5 SMART
IQ 784 806 1.6e0 SMART
Pfam:Myosin_TH1 888 1084 5.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136273
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136701
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Myo1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Myo1b APN 1 51763954 missense possibly damaging 0.94
IGL00943:Myo1b APN 1 51784487 missense probably damaging 0.97
IGL01537:Myo1b APN 1 51776351 missense possibly damaging 0.93
IGL01550:Myo1b APN 1 51784531 missense probably damaging 1.00
IGL01610:Myo1b APN 1 51776246 missense probably damaging 1.00
IGL01667:Myo1b APN 1 51760377 missense probably damaging 1.00
IGL01743:Myo1b APN 1 51782020 missense probably damaging 0.96
IGL01830:Myo1b APN 1 51797465 nonsense probably null
IGL02070:Myo1b APN 1 51794337 missense probably damaging 1.00
IGL02398:Myo1b APN 1 51757891 missense probably damaging 1.00
IGL02582:Myo1b APN 1 51781974 missense possibly damaging 0.88
IGL02685:Myo1b APN 1 51778499 missense probably damaging 1.00
IGL02938:Myo1b APN 1 51801178 splice site probably null
IGL02981:Myo1b APN 1 51778373 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0007:Myo1b UTSW 1 51776254 missense probably damaging 1.00
R0035:Myo1b UTSW 1 51778382 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0040:Myo1b UTSW 1 51781989 missense probably damaging 1.00
R0491:Myo1b UTSW 1 51755698 missense probably benign 0.05
R0959:Myo1b UTSW 1 51797087 missense probably damaging 1.00
R1171:Myo1b UTSW 1 51778525 missense probably damaging 1.00
R1440:Myo1b UTSW 1 51778558 splice site probably benign
R1539:Myo1b UTSW 1 51799563 missense probably damaging 0.97
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R1888:Myo1b UTSW 1 51760403 critical splice acceptor site probably null
R2697:Myo1b UTSW 1 51863358 missense probably benign 0.04
R3034:Myo1b UTSW 1 51773247 missense possibly damaging 0.83
R3720:Myo1b UTSW 1 51776346 missense possibly damaging 0.79
R3896:Myo1b UTSW 1 51773261 missense probably damaging 0.97
R4003:Myo1b UTSW 1 51799530 critical splice donor site probably null
R4179:Myo1b UTSW 1 51778526 missense probably damaging 1.00
R4308:Myo1b UTSW 1 51883109 missense probably benign 0.01
R4444:Myo1b UTSW 1 51757919 missense probably damaging 0.99
R4679:Myo1b UTSW 1 51757973 missense possibly damaging 0.94
R4914:Myo1b UTSW 1 51824208 splice site probably null
R5343:Myo1b UTSW 1 51778537 missense probably benign 0.00
R5530:Myo1b UTSW 1 51797423 missense probably damaging 1.00
R5636:Myo1b UTSW 1 51797528 missense probably damaging 1.00
R5956:Myo1b UTSW 1 51776232 missense probably damaging 1.00
R5974:Myo1b UTSW 1 51778373 missense probably damaging 1.00
R6334:Myo1b UTSW 1 51768651 missense probably null 0.36
R6346:Myo1b UTSW 1 51784507 missense probably damaging 1.00
R6382:Myo1b UTSW 1 51774307 splice site probably null
R6757:Myo1b UTSW 1 51813048 missense probably damaging 1.00
R6952:Myo1b UTSW 1 51762509 missense probably damaging 0.99
X0065:Myo1b UTSW 1 51797395 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCCTACTGAAGGACTGAGGCAC -3'
(R):5'- ATCACTGGGTAAGATTCGTTGGCAG -3'

Sequencing Primer
(F):5'- CATTCAAGTTCCAAGTGCGG -3'
(R):5'- TCGTTGGCAGAGTTTAAAACC -3'
Posted On2014-04-24