Incidental Mutation 'R1616:Tanc1'
ID174221
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59785387 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 246 (D246G)
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect probably damaging
Transcript: ENSMUST00000037526
AA Change: D246G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: D246G

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000056900
Predicted Effect probably damaging
Transcript: ENSMUST00000112568
AA Change: D246G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: D246G

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136248
Predicted Effect probably damaging
Transcript: ENSMUST00000139863
AA Change: D246G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: D246G

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6142:Tanc1 UTSW 2 59833222 nonsense probably null
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTGTCTTTTCCCAGCAAGTG -3'
(R):5'- GGCATGGTCTTACCTGCAACTGAG -3'

Sequencing Primer
(F):5'- CCAGAAAACTTTCCATTGGTGC -3'
(R):5'- TACCTGCAACTGAGTTGGGC -3'
Posted On2014-04-24