Incidental Mutation 'R1616:Sec31a'
ID174245
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 039653-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Possibly essential (E-score: 0.545) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100386195 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 505 (K505N)
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094578
AA Change: K544N

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: K544N

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182812
Predicted Effect possibly damaging
Transcript: ENSMUST00000182886
AA Change: K505N

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: K505N

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182988
AA Change: K244N
Predicted Effect probably benign
Transcript: ENSMUST00000183247
AA Change: K114N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325
AA Change: K114N

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0366:Sec31a UTSW 5 100382766 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 unclassified probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCGACAACACGTTCTAGTTATGCC -3'
(R):5'- TGCTCTGTAACTGAGTCAGCTCCAG -3'

Sequencing Primer
(F):5'- tgaggacgagacaggagg -3'
(R):5'- AGCATCTTTTCCTATAGCATAGCG -3'
Posted On2014-04-24