Incidental Mutation 'R1616:Cbl'
ID174263
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene NameCasitas B-lineage lymphoma
SynonymsCbl-2, c-Cbl
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.542) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location44142976-44234049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44152900 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 780 (Y780N)
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
Predicted Effect probably damaging
Transcript: ENSMUST00000037644
AA Change: Y736N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: Y736N

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205313
Predicted Effect probably damaging
Transcript: ENSMUST00000205968
AA Change: Y763N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206125
Predicted Effect possibly damaging
Transcript: ENSMUST00000206147
AA Change: Y780N

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206258
Predicted Effect probably damaging
Transcript: ENSMUST00000206720
AA Change: Y780N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44201198 missense probably damaging 1.00
IGL01369:Cbl APN 9 44201061 nonsense probably null
IGL01434:Cbl APN 9 44164206 missense probably damaging 0.99
IGL01866:Cbl APN 9 44153825 nonsense probably null
IGL02326:Cbl APN 9 44151473 missense possibly damaging 0.94
IGL02956:Cbl APN 9 44169034 missense probably damaging 1.00
R0068:Cbl UTSW 9 44154194 missense probably damaging 0.98
R0390:Cbl UTSW 9 44201005 missense probably damaging 1.00
R0655:Cbl UTSW 9 44158752 missense probably damaging 1.00
R0764:Cbl UTSW 9 44164152 missense probably damaging 1.00
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1736:Cbl UTSW 9 44152895 missense possibly damaging 0.80
R1808:Cbl UTSW 9 44164229 missense probably damaging 1.00
R1865:Cbl UTSW 9 44164165 missense probably damaging 1.00
R3156:Cbl UTSW 9 44158850 missense possibly damaging 0.74
R3431:Cbl UTSW 9 44151446 makesense probably null
R4668:Cbl UTSW 9 44153848 missense probably benign 0.00
R4700:Cbl UTSW 9 44173380 missense probably damaging 1.00
R4866:Cbl UTSW 9 44152869 missense probably benign 0.00
R4900:Cbl UTSW 9 44152869 missense probably benign 0.00
R4995:Cbl UTSW 9 44153811 missense possibly damaging 0.62
R5014:Cbl UTSW 9 44154399 intron probably null
R5324:Cbl UTSW 9 44154254 missense probably damaging 0.97
R5353:Cbl UTSW 9 44173323 missense probably damaging 1.00
R5382:Cbl UTSW 9 44159021 missense probably benign
R5747:Cbl UTSW 9 44201119 missense probably damaging 1.00
R5834:Cbl UTSW 9 44233779 missense probably damaging 1.00
R6307:Cbl UTSW 9 44158512 critical splice donor site probably null
R6755:Cbl UTSW 9 44173374 missense probably damaging 0.98
X0057:Cbl UTSW 9 44233767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCACCATCTTCAGAGTGTCACTTCC -3'
(R):5'- AGGCTTAACTCACCTCTCTCCACAG -3'

Sequencing Primer
(F):5'- GAGTGTCACTTCCTAATGTAGGACC -3'
(R):5'- CATCCACAGTGGACATTTGAG -3'
Posted On2014-04-24