Incidental Mutation 'R1616:Lama4'
ID174269
Institutional Source Beutler Lab
Gene Symbol Lama4
Ensembl Gene ENSMUSG00000019846
Gene Namelaminin, alpha 4
Synonymslaminin [a]4
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location38965515-39110188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 39075450 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 1064 (F1064V)
Ref Sequence ENSEMBL: ENSMUSP00000019992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019992]
Predicted Effect probably damaging
Transcript: ENSMUST00000019992
AA Change: F1064V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019992
Gene: ENSMUSG00000019846
AA Change: F1064V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EGF_Lam 82 129 1.95e-8 SMART
EGF_Lam 132 184 5.78e-11 SMART
EGF_Lam 187 238 9.83e-14 SMART
Pfam:Laminin_I 283 548 5.3e-71 PFAM
coiled coil region 658 685 N/A INTRINSIC
LamG 850 1009 9.54e-11 SMART
LamG 1066 1205 5.9e-25 SMART
LamG 1250 1374 6.68e-24 SMART
LamG 1484 1619 1.54e-37 SMART
LamG 1661 1794 3.63e-34 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the alpha chain isoform laminin, alpha 4. The domain structure of alpha 4 is similar to that of alpha 3, both of which resemble truncated versions of alpha 1 and alpha 2, in that approximately 1,200 residues at the N-terminus (domains IV, V and VI) have been lost. Laminin, alpha 4 contains the C-terminal G domain which distinguishes all alpha chains from the beta and gamma chains. The RNA analysis from adult and fetal tissues revealed developmental regulation of expression, however, the exact function of laminin, alpha 4 is not known. Tissue-specific utilization of alternative polyA-signal has been described in literature. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired motor control of the hind limbs associated with improperly positioned synaptic active zones and junctional folds, and prenatal and neonatal hemorrhages associated with capillary defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Apol7a C T 15: 77,389,606 G219S probably damaging Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Lama4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Lama4 APN 10 39065595 splice site probably benign
IGL00091:Lama4 APN 10 39072805 missense probably damaging 1.00
IGL00429:Lama4 APN 10 39011026 missense possibly damaging 0.58
IGL00430:Lama4 APN 10 39045704 missense possibly damaging 0.54
IGL01074:Lama4 APN 10 39098488 critical splice donor site probably null
IGL01386:Lama4 APN 10 39011064 missense probably benign 0.00
IGL01603:Lama4 APN 10 39065646 missense possibly damaging 0.92
IGL01643:Lama4 APN 10 39056850 missense probably benign
IGL01655:Lama4 APN 10 39060213 missense probably benign
IGL01954:Lama4 APN 10 39087299 missense probably benign 0.05
IGL01984:Lama4 APN 10 39075529 critical splice donor site probably null
IGL02193:Lama4 APN 10 39042674 missense probably benign
IGL02290:Lama4 APN 10 39017364 missense probably benign 0.00
IGL02441:Lama4 APN 10 39061445 missense probably benign 0.20
IGL02549:Lama4 APN 10 39060204 missense probably benign 0.00
IGL02797:Lama4 APN 10 39056924 missense probably null 0.00
IGL02819:Lama4 APN 10 39026569 missense possibly damaging 0.80
IGL03122:Lama4 APN 10 39067963 missense probably benign
IGL03184:Lama4 APN 10 39078843 missense probably damaging 1.00
IGL03307:Lama4 APN 10 39017383 missense probably benign
R0003:Lama4 UTSW 10 39060222 missense possibly damaging 0.55
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0015:Lama4 UTSW 10 39075436 missense possibly damaging 0.87
R0035:Lama4 UTSW 10 39072738 missense probably benign 0.01
R0141:Lama4 UTSW 10 39092278 missense probably benign 0.05
R0257:Lama4 UTSW 10 39094884 splice site probably benign
R0267:Lama4 UTSW 10 39028639 missense probably damaging 0.96
R0557:Lama4 UTSW 10 39088397 missense probably benign 0.38
R1052:Lama4 UTSW 10 39092245 missense possibly damaging 0.68
R1248:Lama4 UTSW 10 39056847 missense probably damaging 0.99
R1249:Lama4 UTSW 10 39075478 missense probably damaging 1.00
R1291:Lama4 UTSW 10 39048069 missense probably benign 0.00
R1307:Lama4 UTSW 10 39070032 missense probably benign 0.06
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1404:Lama4 UTSW 10 39061391 missense probably benign 0.09
R1443:Lama4 UTSW 10 39073643 missense probably damaging 1.00
R1499:Lama4 UTSW 10 39088880 missense possibly damaging 0.92
R1691:Lama4 UTSW 10 39080563 missense probably benign 0.09
R1748:Lama4 UTSW 10 39065619 missense probably benign 0.01
R1768:Lama4 UTSW 10 39103501 missense possibly damaging 0.82
R1772:Lama4 UTSW 10 39060224 missense probably benign 0.00
R1813:Lama4 UTSW 10 39033125 splice site probably benign
R1813:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1897:Lama4 UTSW 10 39060186 missense probably damaging 1.00
R1907:Lama4 UTSW 10 39072758 missense probably benign 0.13
R1943:Lama4 UTSW 10 39097138 missense possibly damaging 0.85
R2041:Lama4 UTSW 10 39069991 missense probably damaging 1.00
R2242:Lama4 UTSW 10 39026693 missense probably damaging 1.00
R2300:Lama4 UTSW 10 39087320 missense probably benign
R2326:Lama4 UTSW 10 39042567 splice site probably null
R2570:Lama4 UTSW 10 39075358 missense possibly damaging 0.94
R2570:Lama4 UTSW 10 39106047 missense probably damaging 1.00
R2571:Lama4 UTSW 10 39042675 missense possibly damaging 0.55
R2887:Lama4 UTSW 10 39092254 missense possibly damaging 0.94
R2926:Lama4 UTSW 10 39078832 missense probably benign 0.16
R3237:Lama4 UTSW 10 39097179 missense probably damaging 0.97
R4095:Lama4 UTSW 10 39097122 missense probably damaging 1.00
R4151:Lama4 UTSW 10 39005428 missense probably benign 0.00
R4470:Lama4 UTSW 10 39080496 nonsense probably null
R4812:Lama4 UTSW 10 39072769 missense probably benign
R4822:Lama4 UTSW 10 39033053 missense probably benign 0.01
R4997:Lama4 UTSW 10 39092266 missense probably damaging 0.99
R5119:Lama4 UTSW 10 39048054 missense probably benign 0.00
R5468:Lama4 UTSW 10 39072682 intron probably null
R5909:Lama4 UTSW 10 39072859 missense probably benign 0.00
R5917:Lama4 UTSW 10 39048032 missense probably benign 0.10
R5927:Lama4 UTSW 10 39072812 missense probably damaging 1.00
R5950:Lama4 UTSW 10 39030448 missense probably benign 0.03
R6051:Lama4 UTSW 10 39067902 missense probably benign 0.01
R6277:Lama4 UTSW 10 39106010 missense probably damaging 1.00
R6294:Lama4 UTSW 10 39075470 missense probably damaging 1.00
R6372:Lama4 UTSW 10 39067952 missense probably benign
R6532:Lama4 UTSW 10 39048077 missense possibly damaging 0.58
R6547:Lama4 UTSW 10 39073656 missense probably damaging 1.00
R6578:Lama4 UTSW 10 39017365 missense probably benign 0.01
R6737:Lama4 UTSW 10 39094911 missense probably damaging 0.96
R6987:Lama4 UTSW 10 39074279 missense probably benign 0.00
X0067:Lama4 UTSW 10 39045692 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTCCAGAGTCTCACTCAGAAAGC -3'
(R):5'- ACGTTGAAGTATGGACAAGTGCATCTC -3'

Sequencing Primer
(F):5'- CATAGCCAAACCTGTAGCATTCTTG -3'
(R):5'- gaggcagtgacaggcag -3'
Posted On2014-04-24