Incidental Mutation 'R1616:Apol7a'
Institutional Source Beutler Lab
Gene Symbol Apol7a
Ensembl Gene ENSMUSG00000010601
Gene Nameapolipoprotein L 7a
SynonymsApol3, 9130022K13Rik
MMRRC Submission 039653-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1616 (G1)
Quality Score225
Status Not validated
Chromosomal Location77388219-77399110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77389606 bp
Amino Acid Change Glycine to Serine at position 219 (G219S)
Ref Sequence ENSEMBL: ENSMUSP00000134864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010745] [ENSMUST00000175789] [ENSMUST00000175919] [ENSMUST00000176074]
Predicted Effect probably damaging
Transcript: ENSMUST00000010745
AA Change: G219S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000010745
Gene: ENSMUSG00000010601
AA Change: G219S

Pfam:ApoL 20 82 2.4e-13 PFAM
low complexity region 84 95 N/A INTRINSIC
Pfam:ApoL 123 416 1.8e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175789
Predicted Effect probably damaging
Transcript: ENSMUST00000175919
AA Change: G219S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135864
Gene: ENSMUSG00000010601
AA Change: G219S

Pfam:ApoL 20 416 3.1e-138 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176074
AA Change: G219S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134864
Gene: ENSMUSG00000010601
AA Change: G219S

Pfam:ApoL 20 416 3.1e-138 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177135
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 94.3%
  • 20x: 85.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933406P04Rik T C 10: 20,311,341 probably benign Het
A1cf A G 19: 31,934,775 E430G probably damaging Het
Aacs T A 5: 125,484,526 probably null Het
Acot12 G A 13: 91,772,767 V331I probably benign Het
Acp7 A G 7: 28,611,078 W445R probably damaging Het
Actl11 C A 9: 107,931,936 Q1153K probably benign Het
Actr8 A G 14: 29,982,644 T34A possibly damaging Het
Ahnak A G 19: 9,008,987 D2545G possibly damaging Het
Ap5z1 A G 5: 142,472,236 Y388C probably benign Het
Arid1b T A 17: 5,339,294 I1705N probably damaging Het
Bod1l T C 5: 41,808,715 Q2669R probably benign Het
Braf A T 6: 39,643,133 S504T probably benign Het
Cbl A T 9: 44,152,900 Y780N probably damaging Het
Cd86 T C 16: 36,628,976 I20V probably benign Het
Cep290 T G 10: 100,568,836 D2353E probably benign Het
Ckmt2 G A 13: 91,859,209 R289C probably benign Het
Col3a1 T C 1: 45,328,488 probably null Het
Cyp4f16 T A 17: 32,542,968 Y163* probably null Het
Dimt1 T C 13: 106,953,450 V227A possibly damaging Het
Dnah6 A T 6: 73,100,112 M2338K probably benign Het
Dock4 T G 12: 40,669,045 I274S probably damaging Het
Enthd1 T C 15: 80,452,385 D616G probably damaging Het
Fignl2 T C 15: 101,054,116 E95G probably damaging Het
Foxn1 A G 11: 78,358,866 M611T probably benign Het
Foxs1 T C 2: 152,932,639 S165G probably benign Het
Fzd3 G T 14: 65,235,507 Q271K probably benign Het
Hadhb A T 5: 30,166,715 I55F probably damaging Het
Hipk3 G A 2: 104,433,745 Q824* probably null Het
Hps1 G A 19: 42,767,185 R201W probably damaging Het
Kif21b T C 1: 136,171,685 S1477P probably damaging Het
Kif26a A T 12: 112,157,246 probably null Het
Krt90 T C 15: 101,560,591 E172G possibly damaging Het
Lama4 T G 10: 39,075,450 F1064V probably damaging Het
Leng9 A G 7: 4,148,903 V258A probably benign Het
Lgi2 A C 5: 52,546,638 V217G probably benign Het
Lpgat1 T C 1: 191,763,629 I310T possibly damaging Het
Ltbp3 A G 19: 5,746,967 Y374C probably damaging Het
Magi2 C A 5: 20,609,326 T1075K probably damaging Het
Man2c1 T C 9: 57,135,509 I221T probably benign Het
Mydgf A G 17: 56,179,415 M72T possibly damaging Het
Myo1b T C 1: 51,776,315 N624S probably damaging Het
Myo5c T A 9: 75,296,017 M1465K probably damaging Het
Nek4 A T 14: 30,987,137 D716V probably damaging Het
Nfxl1 T A 5: 72,529,037 Q607L probably benign Het
Nlrp9c A T 7: 26,384,437 D572E probably benign Het
Nop14 G T 5: 34,650,413 Q402K possibly damaging Het
Npy5r C G 8: 66,681,400 C247S probably damaging Het
Nrap T A 19: 56,389,823 I19F probably damaging Het
Olfr1189 A G 2: 88,592,008 D68G probably damaging Het
Olfr1336 T G 7: 6,460,745 S79A probably damaging Het
Olfr574 T A 7: 102,948,514 N16K probably damaging Het
Pcdh9 A T 14: 93,886,969 Y588* probably null Het
Ppp1r12a A G 10: 108,260,867 E183G probably damaging Het
Ppp2r2b T A 18: 42,688,310 H261L probably benign Het
Ptch1 G T 13: 63,539,842 T374K possibly damaging Het
Ptpn13 A T 5: 103,565,237 N1742I possibly damaging Het
Rab33a C T X: 48,519,644 S15L probably benign Het
Ralb T C 1: 119,478,014 Y75C probably damaging Het
Rassf7 T A 7: 141,216,732 V2D probably damaging Het
Rbm10 A G X: 20,645,991 N397S probably benign Het
Rbm15 T C 3: 107,330,881 T734A probably benign Het
Rbm8a G T 3: 96,631,730 probably benign Het
Rock2 T C 12: 16,972,985 I1095T probably benign Het
Rxfp3 T A 15: 11,036,303 T328S probably damaging Het
Sec31a T A 5: 100,386,195 K505N possibly damaging Het
Selenof A G 3: 144,596,881 *122W probably null Het
Sh3pxd2b T C 11: 32,381,441 M55T possibly damaging Het
Slc15a2 T C 16: 36,754,481 D522G probably benign Het
Slc2a1 T C 4: 119,136,306 F447L probably damaging Het
Slc45a2 T A 15: 11,022,128 C319S probably null Het
Smad4 T C 18: 73,640,262 D551G probably benign Het
Smarcc2 A G 10: 128,482,793 Y648C probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Stab2 A T 10: 86,885,718 probably null Het
Tanc1 A G 2: 59,785,387 D246G probably damaging Het
Tekt3 T G 11: 63,087,198 probably null Het
Them5 G A 3: 94,346,260 probably null Het
Tlr4 T A 4: 66,839,480 F170Y probably damaging Het
Tmem214 T G 5: 30,871,563 Y165* probably null Het
Tmem94 T C 11: 115,796,145 probably null Het
Tom1l1 A G 11: 90,656,351 L301S possibly damaging Het
Trpm3 A G 19: 22,982,712 E1237G probably damaging Het
Ube2d1 C A 10: 71,256,693 C107F probably damaging Het
Ugt3a1 C T 15: 9,306,244 R160* probably null Het
Vcan G A 13: 89,705,663 P393S probably damaging Het
Virma T C 4: 11,544,954 F1638L probably damaging Het
Vmn1r31 G A 6: 58,472,058 T274I probably damaging Het
Xylt2 C T 11: 94,668,209 S445N probably damaging Het
Zfp457 A G 13: 67,296,311 F43L possibly damaging Het
Zfp879 T A 11: 50,832,646 M455L probably benign Het
Other mutations in Apol7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Apol7a APN 15 77389855 unclassified probably benign
IGL01408:Apol7a APN 15 77389330 missense probably damaging 1.00
IGL01702:Apol7a APN 15 77389686 unclassified probably null
IGL02215:Apol7a APN 15 77393490 missense possibly damaging 0.81
IGL02931:Apol7a APN 15 77393450 nonsense probably null
R0610:Apol7a UTSW 15 77389254 missense probably benign 0.06
R0652:Apol7a UTSW 15 77389855 unclassified probably benign
R1756:Apol7a UTSW 15 77393471 missense possibly damaging 0.93
R3034:Apol7a UTSW 15 77389723 missense probably benign 0.03
R4566:Apol7a UTSW 15 77389751 nonsense probably null
R5059:Apol7a UTSW 15 77389812 unclassified probably benign
R6807:Apol7a UTSW 15 77393320 intron probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gcagaagatgaagatagtgatacag -3'
Posted On2014-04-24