Incidental Mutation 'R1617:Tec'
ID174348
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Nametec protein tyrosine kinase
Synonyms
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location72755716-72868483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72782105 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 189 (F189S)
Ref Sequence ENSEMBL: ENSMUSP00000109224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000149533]
Predicted Effect probably damaging
Transcript: ENSMUST00000071944
AA Change: F189S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: F189S

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073843
AA Change: F189S

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: F189S

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113594
AA Change: F189S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: F189S

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126481
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149533
SMART Domains Protein: ENSMUSP00000123258
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155342
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
BTK 2 33 8.62e-15 SMART
Meta Mutation Damage Score 0.218 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pcdhb5 T G 18: 37,321,402 Y278* probably null Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72768768 missense probably damaging 1.00
IGL00980:Tec APN 5 72786798 missense probably damaging 1.00
IGL01986:Tec APN 5 72782005 nonsense probably null
IGL02505:Tec APN 5 72789244 missense probably damaging 1.00
IGL02522:Tec APN 5 72789172 missense probably benign 0.01
IGL02527:Tec APN 5 72779415 splice site probably null
IGL03292:Tec APN 5 72757364 missense probably null 0.98
IGL02988:Tec UTSW 5 72768747 missense possibly damaging 0.95
PIT4696001:Tec UTSW 5 72773835 missense possibly damaging 0.73
R0254:Tec UTSW 5 72763556 splice site probably benign
R0254:Tec UTSW 5 72783738 missense probably benign 0.12
R0646:Tec UTSW 5 72823497 missense probably damaging 1.00
R1122:Tec UTSW 5 72779449 missense probably damaging 0.96
R1495:Tec UTSW 5 72786755 missense probably damaging 1.00
R3905:Tec UTSW 5 72760362 missense probably damaging 1.00
R3953:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3954:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3955:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3981:Tec UTSW 5 72823599 utr 5 prime probably benign
R4061:Tec UTSW 5 72823409 unclassified probably benign
R4389:Tec UTSW 5 72782007 missense probably benign
R4507:Tec UTSW 5 72760358 missense probably damaging 1.00
R4689:Tec UTSW 5 72823637 start gained probably benign
R4702:Tec UTSW 5 72783731 missense possibly damaging 0.71
R4776:Tec UTSW 5 72768776 missense probably benign 0.38
R4911:Tec UTSW 5 72756351 missense probably benign 0.05
R4923:Tec UTSW 5 72782022 nonsense probably null
R4932:Tec UTSW 5 72760393 nonsense probably null
R5595:Tec UTSW 5 72768744 missense possibly damaging 0.91
R7211:Tec UTSW 5 72782012 missense probably null 0.98
R7404:Tec UTSW 5 72763618 missense probably damaging 1.00
R7465:Tec UTSW 5 72773880 missense probably damaging 1.00
R7526:Tec UTSW 5 72786019 missense probably benign
R7548:Tec UTSW 5 72760350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTCACGATGCTGCAAATTCAG -3'
(R):5'- TTCCAACAGCACCAGCCTTGTC -3'

Sequencing Primer
(F):5'- AGCTGGACTAAGTCTGTTGTAAGC -3'
(R):5'- ACCAGCCTTGTCGTGGAG -3'
Posted On2014-04-24