Incidental Mutation 'R1617:Pcdhb5'
ID174395
Institutional Source Beutler Lab
Gene Symbol Pcdhb5
Ensembl Gene ENSMUSG00000063687
Gene Nameprotocadherin beta 5
SynonymsPcdhb4A, PcdhbE
MMRRC Submission 039654-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1617 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37320381-37323915 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 37321402 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 278 (Y278*)
Ref Sequence ENSEMBL: ENSMUSP00000077389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078271] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect probably null
Transcript: ENSMUST00000078271
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000077389
Gene: ENSMUSG00000063687
AA Change: Y278*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 46 130 1.55e0 SMART
CA 154 239 2.42e-18 SMART
CA 263 344 1.27e-26 SMART
CA 367 448 1.14e-23 SMART
CA 472 558 2.38e-26 SMART
CA 588 669 7.06e-11 SMART
Pfam:Cadherin_C_2 686 769 3.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.624 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency 98% (83/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T A 13: 119,466,937 I91K probably damaging Het
Adamts16 T A 13: 70,798,035 M254L probably benign Het
Adgre5 T C 8: 83,730,177 I192V possibly damaging Het
Akr1c21 G A 13: 4,576,352 probably null Het
Amz2 A G 11: 109,434,024 T245A probably benign Het
Aqp7 A C 4: 41,036,109 M43R probably null Het
Arid3c G A 4: 41,725,103 P315S probably damaging Het
Birc2 A T 9: 7,826,951 Y345N possibly damaging Het
Blnk T C 19: 40,962,363 T115A probably benign Het
Col5a1 T C 2: 27,952,381 S423P unknown Het
Corin A T 5: 72,503,952 F66Y possibly damaging Het
Cpd A T 11: 76,846,669 W100R probably damaging Het
Cpsf1 A T 15: 76,602,370 Y296* probably null Het
Cyp2d34 T C 15: 82,620,845 T5A probably benign Het
Dhrs7c G T 11: 67,815,077 V219L possibly damaging Het
Dnah3 T C 7: 120,089,946 M82V probably benign Het
Dnah9 A G 11: 65,895,921 S3629P probably damaging Het
Fam160a2 A G 7: 105,385,062 L454P probably damaging Het
Fbrs T C 7: 127,487,711 L33P probably damaging Het
Galnt11 T A 5: 25,258,893 S388T probably damaging Het
Glmp A G 3: 88,328,119 probably benign Het
Gm13178 T G 4: 144,715,391 T97P probably damaging Het
Gm13212 A T 4: 145,624,307 probably benign Het
Gm9268 A G 7: 43,024,079 E187G probably benign Het
Gm9894 A G 13: 67,772,726 noncoding transcript Het
Grik3 A G 4: 125,691,192 M618V probably benign Het
Hmcn1 T C 1: 150,745,027 D1144G probably damaging Het
Hnrnpa2b1 T C 6: 51,466,398 K161R possibly damaging Het
Kmt2c T C 5: 25,375,927 I523V probably benign Het
Lmln C T 16: 33,117,130 P622S probably damaging Het
Lmtk2 A G 5: 144,173,862 T467A probably damaging Het
Map1s T A 8: 70,913,451 N333K probably damaging Het
Mgat4d C A 8: 83,365,711 A242D probably damaging Het
Muc5b T A 7: 141,863,524 Y3402* probably null Het
Myo3b G T 2: 70,281,218 A922S probably benign Het
Nphs1 T C 7: 30,482,531 V1183A probably benign Het
Nup160 T A 2: 90,679,499 C31S probably benign Het
Olfr1061 A T 2: 86,413,691 Y120* probably null Het
Olfr48 T C 2: 89,844,254 T240A probably benign Het
Pkhd1 T A 1: 20,198,050 E3368V possibly damaging Het
Pla2g6 A G 15: 79,289,141 M676T probably benign Het
Plcb1 A T 2: 135,337,441 N590Y probably damaging Het
Prr12 G A 7: 45,049,594 probably benign Het
Psat1 A G 19: 15,924,302 probably null Het
Ptpn9 T G 9: 57,027,408 I152S possibly damaging Het
Ric8b T A 10: 84,947,611 F111Y probably damaging Het
Slc44a3 G A 3: 121,461,265 A568V probably benign Het
Smarcd3 T G 5: 24,595,194 R213S probably damaging Het
Snx13 T C 12: 35,086,896 Y119H probably damaging Het
Socs2 C A 10: 95,413,081 E57* probably null Het
Spred1 C T 2: 117,175,347 P197S probably benign Het
Srek1 G T 13: 103,743,604 P482Q unknown Het
Tapbp A G 17: 33,920,431 T134A probably benign Het
Tarbp1 T C 8: 126,444,268 I998V possibly damaging Het
Tbcel G T 9: 42,461,293 probably benign Het
Tec A G 5: 72,782,105 F189S probably damaging Het
Tmprss11g A T 5: 86,499,563 Y39N probably damaging Het
Tmtc1 A G 6: 148,355,404 probably benign Het
Trpa1 A G 1: 14,873,675 I1070T probably damaging Het
Trpm2 T A 10: 77,935,875 probably null Het
Ttc21b G T 2: 66,226,035 T669K probably benign Het
Ttll4 G A 1: 74,679,401 R137H probably benign Het
Ubqln3 G T 7: 104,142,860 L8I possibly damaging Het
Ung C A 5: 114,131,354 N42K probably benign Het
Upp1 T C 11: 9,134,865 S195P probably damaging Het
Urb1 T C 16: 90,760,452 E1762G possibly damaging Het
Utp11 T C 4: 124,686,111 K35E probably damaging Het
Vav3 A T 3: 109,510,978 K305I probably damaging Het
Vmn1r197 A G 13: 22,328,328 I140V possibly damaging Het
Zfc3h1 A G 10: 115,390,922 T295A probably benign Het
Zfp46 T C 4: 136,290,512 L219P probably damaging Het
Zfp493 G A 13: 67,783,880 V33M probably damaging Het
Zfp92 T C X: 73,419,860 probably benign Het
Other mutations in Pcdhb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Pcdhb5 APN 18 37322109 missense probably damaging 1.00
IGL00895:Pcdhb5 APN 18 37320983 missense probably benign 0.42
IGL00896:Pcdhb5 APN 18 37322785 intron probably null
IGL01385:Pcdhb5 APN 18 37322214 missense probably benign 0.00
IGL01619:Pcdhb5 APN 18 37322939 missense probably damaging 1.00
IGL01712:Pcdhb5 APN 18 37321253 missense probably damaging 1.00
IGL01716:Pcdhb5 APN 18 37321022 missense probably benign
IGL01719:Pcdhb5 APN 18 37321022 missense probably benign
IGL01720:Pcdhb5 APN 18 37321022 missense probably benign
IGL01723:Pcdhb5 APN 18 37321022 missense probably benign
IGL01724:Pcdhb5 APN 18 37321022 missense probably benign
IGL01839:Pcdhb5 APN 18 37321449 missense probably damaging 0.98
IGL01884:Pcdhb5 APN 18 37321334 missense probably benign 0.00
IGL01962:Pcdhb5 APN 18 37321040 missense probably damaging 1.00
IGL02088:Pcdhb5 APN 18 37321959 missense probably benign 0.11
IGL02299:Pcdhb5 APN 18 37320890 missense probably benign
IGL02444:Pcdhb5 APN 18 37321050 missense probably benign 0.01
IGL03372:Pcdhb5 APN 18 37320660 missense probably benign 0.22
R0034:Pcdhb5 UTSW 18 37322084 missense probably damaging 1.00
R0047:Pcdhb5 UTSW 18 37321268 missense possibly damaging 0.87
R0179:Pcdhb5 UTSW 18 37322559 missense probably damaging 1.00
R0466:Pcdhb5 UTSW 18 37322543 missense probably damaging 1.00
R0471:Pcdhb5 UTSW 18 37321306 nonsense probably null
R0565:Pcdhb5 UTSW 18 37320767 missense possibly damaging 0.91
R0646:Pcdhb5 UTSW 18 37321622 missense probably benign
R1014:Pcdhb5 UTSW 18 37322250 missense probably damaging 1.00
R1676:Pcdhb5 UTSW 18 37320752 missense probably benign 0.01
R1774:Pcdhb5 UTSW 18 37322672 missense probably damaging 0.99
R1826:Pcdhb5 UTSW 18 37321469 nonsense probably null
R1854:Pcdhb5 UTSW 18 37322340 missense possibly damaging 0.94
R2355:Pcdhb5 UTSW 18 37322116 missense probably benign
R4290:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4292:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4293:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4294:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4295:Pcdhb5 UTSW 18 37322681 missense possibly damaging 0.90
R4391:Pcdhb5 UTSW 18 37322736 missense possibly damaging 0.88
R4411:Pcdhb5 UTSW 18 37321997 missense possibly damaging 0.80
R4480:Pcdhb5 UTSW 18 37320752 missense probably benign 0.43
R4852:Pcdhb5 UTSW 18 37322471 missense probably benign 0.04
R5121:Pcdhb5 UTSW 18 37321117 missense probably benign 0.11
R5133:Pcdhb5 UTSW 18 37320890 missense probably benign
R5630:Pcdhb5 UTSW 18 37321155 missense possibly damaging 0.88
R5833:Pcdhb5 UTSW 18 37321102 missense probably damaging 0.99
R5896:Pcdhb5 UTSW 18 37322679 nonsense probably null
R5942:Pcdhb5 UTSW 18 37320785 nonsense probably null
R5945:Pcdhb5 UTSW 18 37321470 missense probably benign 0.08
R5970:Pcdhb5 UTSW 18 37321773 missense probably damaging 1.00
R6045:Pcdhb5 UTSW 18 37321575 missense probably damaging 1.00
R6054:Pcdhb5 UTSW 18 37321080 missense probably damaging 0.98
R6147:Pcdhb5 UTSW 18 37320726 missense probably damaging 1.00
R6152:Pcdhb5 UTSW 18 37322833 nonsense probably null
R6193:Pcdhb5 UTSW 18 37322027 missense probably damaging 1.00
R6397:Pcdhb5 UTSW 18 37321505 missense probably benign 0.08
R6505:Pcdhb5 UTSW 18 37320880 missense probably benign 0.00
R6608:Pcdhb5 UTSW 18 37321823 missense probably damaging 0.98
R6737:Pcdhb5 UTSW 18 37322670 missense probably damaging 1.00
R7146:Pcdhb5 UTSW 18 37321356 missense probably damaging 1.00
R7162:Pcdhb5 UTSW 18 37321686 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCAGCAATGGGCTTCAACAATACAC -3'
(R):5'- GCATTGTCGTTCACATCCAACACC -3'

Sequencing Primer
(F):5'- AATCCTCACAGCTCTGGATGG -3'
(R):5'- CTCTATCACCACAGAGCCCTTC -3'
Posted On2014-04-24