Incidental Mutation 'R1618:Zbtb46'
ID174413
Institutional Source Beutler Lab
Gene Symbol Zbtb46
Ensembl Gene ENSMUSG00000027583
Gene Namezinc finger and BTB domain containing 46
Synonyms2610019F01Rik, Btbd4, 4933406L05Rik
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181387762-181459426 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181424249 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 36 (V36E)
Ref Sequence ENSEMBL: ENSMUSP00000125584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029106] [ENSMUST00000087409] [ENSMUST00000155535] [ENSMUST00000180222]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029106
AA Change: V36E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029106
Gene: ENSMUSG00000027583
AA Change: V36E

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000087409
AA Change: V36E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000084672
Gene: ENSMUSG00000027583
AA Change: V36E

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146446
Predicted Effect possibly damaging
Transcript: ENSMUST00000155535
AA Change: V36E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158987
Predicted Effect possibly damaging
Transcript: ENSMUST00000180222
AA Change: V36E

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137014
Gene: ENSMUSG00000027583
AA Change: V36E

DomainStartEndE-ValueType
BTB 31 129 2.89e-21 SMART
ZnF_C2H2 418 440 4.72e-2 SMART
ZnF_C2H2 446 468 4.24e-4 SMART
ZnF_C2H2 474 498 1.31e2 SMART
low complexity region 543 557 N/A INTRINSIC
low complexity region 568 580 N/A INTRINSIC
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit repressed altered myeloid potential in dendritic cells. Mice homozygous for a different knock-out allele exhibit partial activation of classical dendritic cells in the steady state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A possibly damaging Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Zbtb46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Zbtb46 APN 2 181424135 missense possibly damaging 0.48
IGL02401:Zbtb46 APN 2 181423452 missense probably benign 0.01
R0127:Zbtb46 UTSW 2 181411815 missense probably benign 0.32
R0279:Zbtb46 UTSW 2 181411774 missense possibly damaging 0.67
R1711:Zbtb46 UTSW 2 181411684 missense probably damaging 1.00
R1785:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1786:Zbtb46 UTSW 2 181391431 missense probably damaging 1.00
R1906:Zbtb46 UTSW 2 181423839 missense probably damaging 1.00
R4170:Zbtb46 UTSW 2 181424355 start codon destroyed probably null 0.98
R4782:Zbtb46 UTSW 2 181391136 missense probably benign
R5656:Zbtb46 UTSW 2 181423417 critical splice donor site probably null
R5808:Zbtb46 UTSW 2 181423570 missense probably benign 0.00
R5932:Zbtb46 UTSW 2 181411920 missense probably benign 0.00
R6360:Zbtb46 UTSW 2 181391455 missense probably damaging 1.00
R6467:Zbtb46 UTSW 2 181391269 missense probably damaging 1.00
R6672:Zbtb46 UTSW 2 181411836 missense probably benign 0.01
R6960:Zbtb46 UTSW 2 181423424 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGACATCACCTCGATGACATTCC -3'
(R):5'- TGCATGTCCATGACTGCCATTTACC -3'

Sequencing Primer
(F):5'- ACTAGTGAGAGCCAGATGGG -3'
(R):5'- CATGACTGCCATTTACCTTGAC -3'
Posted On2014-04-24