Incidental Mutation 'R1618:Oprl1'
ID174414
Institutional Source Beutler Lab
Gene Symbol Oprl1
Ensembl Gene ENSMUSG00000027584
Gene Nameopioid receptor-like 1
SynonymsORL1, morc, N/OFQ receptor, MOR-C, nociceptin/ orphaninFQ receptor, LC132, XOR1
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location181715016-181720985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 181718853 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 207 (Y207F)
Ref Sequence ENSEMBL: ENSMUSP00000104399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071585] [ENSMUST00000108763] [ENSMUST00000108766] [ENSMUST00000108767] [ENSMUST00000108768] [ENSMUST00000148334] [ENSMUST00000183693] [ENSMUST00000184127] [ENSMUST00000184795]
Predicted Effect probably benign
Transcript: ENSMUST00000071585
AA Change: Y207F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071513
Gene: ENSMUSG00000027584
AA Change: Y207F

DomainStartEndE-ValueType
Pfam:7tm_4 54 334 5.8e-9 PFAM
Pfam:7TM_GPCR_Srx 56 264 1.4e-6 PFAM
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 1.4e-62 PFAM
Pfam:7TM_GPCR_Srv 112 332 7.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108763
AA Change: Y193F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000104394
Gene: ENSMUSG00000027584
AA Change: Y193F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 317 6.9e-11 PFAM
Pfam:7tm_1 60 302 1.6e-62 PFAM
Pfam:7TM_GPCR_Srv 91 318 4.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108766
SMART Domains Protein: ENSMUSP00000104397
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 56 189 3.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 59 201 1.8e-9 PFAM
Pfam:7tm_1 65 210 1.6e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108767
AA Change: Y207F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104398
Gene: ENSMUSG00000027584
AA Change: Y207F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108768
AA Change: Y207F

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104399
Gene: ENSMUSG00000027584
AA Change: Y207F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 59 331 1.2e-14 PFAM
Pfam:7tm_1 65 316 2.1e-66 PFAM
Pfam:7TM_GPCR_Srv 105 332 7.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126835
Predicted Effect probably benign
Transcript: ENSMUST00000148334
SMART Domains Protein: ENSMUSP00000118664
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
Pfam:7tm_1 65 140 5.9e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151241
Predicted Effect probably benign
Transcript: ENSMUST00000183693
SMART Domains Protein: ENSMUSP00000138810
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 77 1e-3 SMART
PDB:4EA3|B 41 76 9e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184127
SMART Domains Protein: ENSMUSP00000139119
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 76 3e-4 SMART
PDB:4EA3|B 41 76 1e-16 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000184795
SMART Domains Protein: ENSMUSP00000138979
Gene: ENSMUSG00000027584

DomainStartEndE-ValueType
SCOP:d1l9ha_ 21 71 2e-3 SMART
PDB:4EA3|B 41 71 5e-13 PDB
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the 7 transmembrane-spanning G protein-coupled receptor family, and functions as a receptor for the endogenous, opioid-related neuropeptide, nociceptin/orphanin FQ. This receptor-ligand system modulates a variety of biological functions and neurobehavior, including stress responses and anxiety behavior, learning and memory, locomotor activity, and inflammatory and immune responses. Alternatively spliced transcript variants have been described for this gene. A recent study provided evidence for translational readthrough in this gene and expression of an additional C-terminally extended isoform via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit altered touch/nociception, facilitation of long-term potentiation and memory, increased dopamine release upon administration of opioid peptide agonist, impaired behavioral response to morphine, and increased susceptibility to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A possibly damaging Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Oprl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02977:Oprl1 APN 2 181718511 missense probably damaging 1.00
R0302:Oprl1 UTSW 2 181719228 missense probably benign 0.01
R0453:Oprl1 UTSW 2 181718734 critical splice donor site probably null
R1564:Oprl1 UTSW 2 181718940 missense possibly damaging 0.79
R4801:Oprl1 UTSW 2 181719253 missense probably benign
R4802:Oprl1 UTSW 2 181719253 missense probably benign
R5032:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R5133:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R5134:Oprl1 UTSW 2 181718610 missense probably damaging 0.99
R6284:Oprl1 UTSW 2 181717991 intron probably benign
R6374:Oprl1 UTSW 2 181715928 missense probably damaging 1.00
R6394:Oprl1 UTSW 2 181719002 missense probably damaging 1.00
R6843:Oprl1 UTSW 2 181715754 missense probably damaging 1.00
R7009:Oprl1 UTSW 2 181718381 missense probably damaging 1.00
X0022:Oprl1 UTSW 2 181715807 missense probably benign 0.28
X0024:Oprl1 UTSW 2 181718548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGGACATCCAGTAAAGCCCAGG -3'
(R):5'- TGCAGAAGCGCAGAATGGCTAC -3'

Sequencing Primer
(F):5'- CCCTGGCTTCGGTGGTTG -3'
(R):5'- AGTCTCACTACCTGGCTGAAC -3'
Posted On2014-04-24