Incidental Mutation 'R1618:Sbno1'
ID174425
Institutional Source Beutler Lab
Gene Symbol Sbno1
Ensembl Gene ENSMUSG00000038095
Gene Namestrawberry notch 1
Synonyms9330180L10Rik, sno
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.939) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location124368702-124426001 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124404216 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 338 (Y338C)
Ref Sequence ENSEMBL: ENSMUSP00000142481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065263] [ENSMUST00000168651] [ENSMUST00000196329] [ENSMUST00000196644] [ENSMUST00000196711] [ENSMUST00000199004] [ENSMUST00000199808] [ENSMUST00000200474]
Predicted Effect probably damaging
Transcript: ENSMUST00000065263
AA Change: Y338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066808
Gene: ENSMUSG00000038095
AA Change: Y338C

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168651
AA Change: Y337C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130860
Gene: ENSMUSG00000038095
AA Change: Y337C

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 254 559 3.6e-144 PFAM
Pfam:ResIII 287 478 2.7e-8 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 3.6e-126 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196329
AA Change: Y303C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143084
Gene: ENSMUSG00000038095
AA Change: Y303C

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Pfam:AAA_34 217 525 1.4e-139 PFAM
Pfam:ResIII 254 441 2.4e-8 PFAM
low complexity region 598 614 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196644
AA Change: Y338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142827
Gene: ENSMUSG00000038095
AA Change: Y338C

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 4.3e-136 PFAM
Pfam:ResIII 289 476 1.8e-6 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196711
SMART Domains Protein: ENSMUSP00000142980
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 35 51 N/A INTRINSIC
low complexity region 182 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199004
SMART Domains Protein: ENSMUSP00000143314
Gene: ENSMUSG00000038095

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199808
AA Change: Y338C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142481
Gene: ENSMUSG00000038095
AA Change: Y338C

DomainStartEndE-ValueType
low complexity region 217 234 N/A INTRINSIC
Pfam:AAA_34 252 560 6e-139 PFAM
Pfam:ResIII 289 476 1.3e-7 PFAM
low complexity region 633 649 N/A INTRINSIC
low complexity region 727 748 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 815 838 N/A INTRINSIC
coiled coil region 839 868 N/A INTRINSIC
Pfam:Helicase_C_4 870 1146 4.6e-120 PFAM
low complexity region 1365 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000200474
AA Change: Y302C

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143516
Gene: ENSMUSG00000038095
AA Change: Y302C

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 181 198 N/A INTRINSIC
Pfam:AAA_34 218 523 2.3e-141 PFAM
Pfam:ResIII 251 442 3.3e-7 PFAM
low complexity region 597 613 N/A INTRINSIC
low complexity region 691 712 N/A INTRINSIC
low complexity region 743 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000200674
AA Change: Y89C
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A possibly damaging Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Sbno1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Sbno1 APN 5 124402205 missense probably damaging 1.00
IGL01154:Sbno1 APN 5 124410249 missense probably damaging 1.00
IGL01309:Sbno1 APN 5 124381706 missense probably benign 0.41
IGL01330:Sbno1 APN 5 124391979 missense probably damaging 1.00
IGL01541:Sbno1 APN 5 124378555 splice site probably benign
IGL01800:Sbno1 APN 5 124381505 splice site probably benign
IGL01987:Sbno1 APN 5 124404219 missense probably damaging 1.00
IGL02178:Sbno1 APN 5 124400195 splice site probably null
IGL02544:Sbno1 APN 5 124403983 missense probably damaging 0.99
IGL02572:Sbno1 APN 5 124381677 splice site probably benign
IGL02592:Sbno1 APN 5 124400809 missense probably damaging 1.00
IGL03033:Sbno1 APN 5 124376150 missense probably damaging 0.97
IGL03089:Sbno1 APN 5 124387311 splice site probably benign
IGL03131:Sbno1 APN 5 124388605 missense probably damaging 1.00
Decrement UTSW 5 124400847 missense probably damaging 1.00
R0200:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0217:Sbno1 UTSW 5 124404324 critical splice acceptor site probably null
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0233:Sbno1 UTSW 5 124376226 missense probably damaging 1.00
R0334:Sbno1 UTSW 5 124386868 missense possibly damaging 0.79
R0401:Sbno1 UTSW 5 124410285 missense probably damaging 0.96
R0608:Sbno1 UTSW 5 124384541 missense probably damaging 1.00
R0615:Sbno1 UTSW 5 124410139 missense probably damaging 1.00
R0653:Sbno1 UTSW 5 124386892 missense possibly damaging 0.79
R0655:Sbno1 UTSW 5 124376149 missense possibly damaging 0.95
R1037:Sbno1 UTSW 5 124393912 missense possibly damaging 0.92
R1439:Sbno1 UTSW 5 124384460 splice site probably benign
R1522:Sbno1 UTSW 5 124392612 missense probably damaging 1.00
R1590:Sbno1 UTSW 5 124384504 missense possibly damaging 0.55
R1671:Sbno1 UTSW 5 124392067 splice site probably null
R1779:Sbno1 UTSW 5 124388517 unclassified probably benign
R2103:Sbno1 UTSW 5 124393937 missense probably damaging 0.98
R2136:Sbno1 UTSW 5 124387534 synonymous probably null
R2149:Sbno1 UTSW 5 124402119 synonymous probably null
R2153:Sbno1 UTSW 5 124378543 missense probably benign
R2154:Sbno1 UTSW 5 124378511 missense probably benign
R2231:Sbno1 UTSW 5 124405704 missense probably damaging 1.00
R2879:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R3004:Sbno1 UTSW 5 124381708 missense probably damaging 0.96
R3922:Sbno1 UTSW 5 124381930 missense probably damaging 1.00
R4061:Sbno1 UTSW 5 124388572 missense probably damaging 1.00
R4096:Sbno1 UTSW 5 124391920 critical splice donor site probably null
R4612:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4879:Sbno1 UTSW 5 124404024 missense probably damaging 1.00
R4937:Sbno1 UTSW 5 124374609 missense possibly damaging 0.93
R4990:Sbno1 UTSW 5 124400165 missense probably damaging 1.00
R5341:Sbno1 UTSW 5 124408475 critical splice donor site probably null
R5365:Sbno1 UTSW 5 124381866 frame shift probably null
R5399:Sbno1 UTSW 5 124392741 missense probably benign 0.09
R5704:Sbno1 UTSW 5 124395893 critical splice donor site probably null
R5898:Sbno1 UTSW 5 124386791 intron probably benign
R6136:Sbno1 UTSW 5 124378491 missense probably benign 0.41
R6154:Sbno1 UTSW 5 124378479 missense possibly damaging 0.94
R6412:Sbno1 UTSW 5 124392714 missense probably damaging 0.99
R6414:Sbno1 UTSW 5 124395931 missense probably benign 0.28
R6454:Sbno1 UTSW 5 124400847 missense probably damaging 1.00
R7085:Sbno1 UTSW 5 124381720 missense not run
Z1088:Sbno1 UTSW 5 124393958 missense possibly damaging 0.91
Z1088:Sbno1 UTSW 5 124404304 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGATTGATAGCCCCACTGAACAAGG -3'
(R):5'- GCTAACTGTCCCCATGATTTACGTACC -3'

Sequencing Primer
(F):5'- CCATACCTTATTTAACGAATGGACC -3'
(R):5'- TTACGTACCACATGGAAGTTGG -3'
Posted On2014-04-24