Incidental Mutation 'R1618:Trpm1'
ID174430
Institutional Source Beutler Lab
Gene Symbol Trpm1
Ensembl Gene ENSMUSG00000030523
Gene Nametransient receptor potential cation channel, subfamily M, member 1
SynonymsMlsn1, 4732499L03Rik, LTRPC1, melastatin
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location64153835-64269775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64240535 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 962 (R962H)
Ref Sequence ENSEMBL: ENSMUSP00000146226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206848]
Predicted Effect probably damaging
Transcript: ENSMUST00000085222
AA Change: R962H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: R962H

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
transmembrane domain 876 895 N/A INTRINSIC
Pfam:Ion_trans 907 1120 6e-16 PFAM
transmembrane domain 1150 1167 N/A INTRINSIC
low complexity region 1216 1225 N/A INTRINSIC
PDB:3E7K|H 1228 1279 1e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000107525
AA Change: R962H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103149
Gene: ENSMUSG00000030523
AA Change: R962H

DomainStartEndE-ValueType
low complexity region 8 28 N/A INTRINSIC
low complexity region 183 195 N/A INTRINSIC
low complexity region 289 307 N/A INTRINSIC
low complexity region 456 491 N/A INTRINSIC
Blast:ANK 505 533 1e-5 BLAST
low complexity region 621 650 N/A INTRINSIC
low complexity region 823 835 N/A INTRINSIC
Pfam:Ion_trans 876 1138 7.6e-22 PFAM
transmembrane domain 1156 1173 N/A INTRINSIC
Pfam:TRPM_tetra 1230 1285 9.4e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206000
Predicted Effect probably damaging
Transcript: ENSMUST00000206263
AA Change: R846H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206277
AA Change: R962H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206314
Predicted Effect probably benign
Transcript: ENSMUST00000206848
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A possibly damaging Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Trpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Trpm1 APN 7 64243450 missense probably damaging 1.00
IGL00465:Trpm1 APN 7 64247467 missense possibly damaging 0.94
IGL01118:Trpm1 APN 7 64235824 missense probably benign 0.24
IGL01148:Trpm1 APN 7 64243564 missense probably damaging 1.00
IGL01303:Trpm1 APN 7 64210830 critical splice acceptor site probably benign 0.00
IGL01432:Trpm1 APN 7 64235019 missense probably benign 0.18
IGL01433:Trpm1 APN 7 64204528 missense probably damaging 1.00
IGL01506:Trpm1 APN 7 64243581 missense probably damaging 1.00
IGL01626:Trpm1 APN 7 64268889 missense probably damaging 1.00
IGL01640:Trpm1 APN 7 64226897 missense probably damaging 1.00
IGL01899:Trpm1 APN 7 64234994 missense probably benign 0.24
IGL01959:Trpm1 APN 7 64208975 missense possibly damaging 0.81
IGL02210:Trpm1 APN 7 64210865 missense probably damaging 1.00
IGL02268:Trpm1 APN 7 64217614 missense probably damaging 0.96
IGL02331:Trpm1 APN 7 64235052 missense probably benign 0.30
IGL02334:Trpm1 APN 7 64245942 critical splice acceptor site probably null
IGL02407:Trpm1 APN 7 64219121 missense probably damaging 1.00
IGL02425:Trpm1 APN 7 64240427 missense probably damaging 0.96
IGL02485:Trpm1 APN 7 64269114 missense possibly damaging 0.52
IGL02635:Trpm1 APN 7 64199224 missense probably benign 0.00
IGL02640:Trpm1 APN 7 64219133 missense probably damaging 0.97
IGL02827:Trpm1 APN 7 64219160 missense probably null 1.00
R0012:Trpm1 UTSW 7 64268591 missense possibly damaging 0.88
R0014:Trpm1 UTSW 7 64248222 missense probably damaging 1.00
R0056:Trpm1 UTSW 7 64243586 missense probably damaging 1.00
R0445:Trpm1 UTSW 7 64244842 unclassified probably benign
R0463:Trpm1 UTSW 7 64220254 missense probably benign 0.05
R0469:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R0510:Trpm1 UTSW 7 64223758 missense probably damaging 1.00
R1301:Trpm1 UTSW 7 64203053 unclassified probably null
R1397:Trpm1 UTSW 7 64217658 missense probably damaging 1.00
R1588:Trpm1 UTSW 7 64223817 missense possibly damaging 0.93
R1724:Trpm1 UTSW 7 64235821 nonsense probably null
R1827:Trpm1 UTSW 7 64235007 missense probably damaging 1.00
R1829:Trpm1 UTSW 7 64226782 missense probably damaging 1.00
R1835:Trpm1 UTSW 7 64230268 missense probably damaging 1.00
R1864:Trpm1 UTSW 7 64268016 missense probably damaging 1.00
R1895:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1946:Trpm1 UTSW 7 64223808 missense probably damaging 1.00
R1959:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1960:Trpm1 UTSW 7 64230230 missense probably damaging 1.00
R1980:Trpm1 UTSW 7 64208434 missense possibly damaging 0.83
R1989:Trpm1 UTSW 7 64209032 intron probably null
R2054:Trpm1 UTSW 7 64240555 missense possibly damaging 0.69
R2156:Trpm1 UTSW 7 64234988 missense probably damaging 1.00
R2251:Trpm1 UTSW 7 64209976 missense probably damaging 1.00
R3051:Trpm1 UTSW 7 64269101 missense probably damaging 1.00
R3148:Trpm1 UTSW 7 64235012 missense probably benign 0.00
R3195:Trpm1 UTSW 7 64199313 nonsense probably null
R3615:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3616:Trpm1 UTSW 7 64243570 missense probably damaging 1.00
R3623:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3624:Trpm1 UTSW 7 64244853 missense probably damaging 1.00
R3721:Trpm1 UTSW 7 64217727 intron probably benign
R3822:Trpm1 UTSW 7 64217703 intron probably benign
R4441:Trpm1 UTSW 7 64201918 missense probably damaging 1.00
R4490:Trpm1 UTSW 7 64208912 nonsense probably null
R4666:Trpm1 UTSW 7 64203034 missense probably damaging 1.00
R4701:Trpm1 UTSW 7 64243500 missense probably damaging 1.00
R4781:Trpm1 UTSW 7 64235052 missense probably benign 0.30
R4811:Trpm1 UTSW 7 64208306 missense probably damaging 1.00
R5017:Trpm1 UTSW 7 64244832 unclassified probably benign
R5030:Trpm1 UTSW 7 64235831 missense probably damaging 1.00
R5195:Trpm1 UTSW 7 64237693 missense possibly damaging 0.84
R5238:Trpm1 UTSW 7 64268954 missense probably damaging 1.00
R5304:Trpm1 UTSW 7 64208946 missense probably benign 0.00
R5575:Trpm1 UTSW 7 64220270 missense possibly damaging 0.95
R5613:Trpm1 UTSW 7 64208411 missense probably damaging 1.00
R5855:Trpm1 UTSW 7 64268962 nonsense probably null
R5947:Trpm1 UTSW 7 64223799 missense probably benign 0.07
R5988:Trpm1 UTSW 7 64226805 missense probably benign 0.16
R6054:Trpm1 UTSW 7 64268702 missense probably benign 0.00
R6088:Trpm1 UTSW 7 64267976 missense probably damaging 0.98
R6259:Trpm1 UTSW 7 64268478 missense possibly damaging 0.47
R6379:Trpm1 UTSW 7 64199194 missense probably benign 0.00
R6380:Trpm1 UTSW 7 64268297 missense probably benign 0.24
R6429:Trpm1 UTSW 7 64268504 missense probably benign 0.00
R6600:Trpm1 UTSW 7 64154033 start codon destroyed probably null 0.56
R6622:Trpm1 UTSW 7 64240595 missense probably damaging 0.96
R6939:Trpm1 UTSW 7 64268297 missense probably benign 0.03
R6944:Trpm1 UTSW 7 64243433 missense probably damaging 1.00
X0026:Trpm1 UTSW 7 64268910 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGCATTTCCTGCGTCTATGAAACCC -3'
(R):5'- ACACCCTAGCTTGGTTTGGTGCTC -3'

Sequencing Primer
(F):5'- CATGTGCAGAATTCAGTGCC -3'
(R):5'- GGTGCTCTAATGCCAAGTTATC -3'
Posted On2014-04-24