Incidental Mutation 'R1618:Coro1a'
ID174434
Institutional Source Beutler Lab
Gene Symbol Coro1a
Ensembl Gene ENSMUSG00000030707
Gene Namecoronin, actin binding protein 1A
SynonymsClabp, Lmb3, coronin 1, p57
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1618 (G1)
Quality Score175
Status Validated
Chromosome7
Chromosomal Location126699773-126707787 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 126701547 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 162 (I162V)
Ref Sequence ENSEMBL: ENSMUSP00000146177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032949] [ENSMUST00000106364] [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000131415] [ENSMUST00000135087] [ENSMUST00000173108] [ENSMUST00000173116] [ENSMUST00000205515]
Predicted Effect probably benign
Transcript: ENSMUST00000032949
AA Change: I203V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032949
Gene: ENSMUSG00000030707
AA Change: I203V

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
PDB:2AKF|C 430 461 3e-13 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect probably benign
Transcript: ENSMUST00000106364
AA Change: I203V

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101972
Gene: ENSMUSG00000030707
AA Change: I203V

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 392 1.23e-89 SMART
Pfam:Trimer_CC 410 461 4.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126193
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131415
AA Change: I203V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117931
Gene: ENSMUSG00000030707
AA Change: I203V

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133718
Predicted Effect probably benign
Transcript: ENSMUST00000135087
SMART Domains Protein: ENSMUSP00000115960
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect probably benign
Transcript: ENSMUST00000173108
AA Change: I203V

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134123
Gene: ENSMUSG00000030707
AA Change: I203V

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
WD40 120 160 2.42e-7 SMART
WD40 163 204 6.09e-4 SMART
DUF1900 258 365 3.06e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173116
SMART Domains Protein: ENSMUSP00000133555
Gene: ENSMUSG00000030707

DomainStartEndE-ValueType
DUF1899 4 68 1.6e-33 SMART
WD40 67 110 1.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174579
Predicted Effect probably benign
Transcript: ENSMUST00000205515
AA Change: I162V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: This gene encodes a member of the WD repeat coronin family. The encoded protein may bind actin and interact with microtubules. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for null or hypomorph alleles of this gene display lower peripheral T cell counts resulting from defects in T cell migration and increased rates of apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A possibly damaging Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Csnk1e A T 15: 79,424,850 M292K probably benign Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Coro1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Coro1a APN 7 126701529 missense probably benign 0.00
IGL02307:Coro1a APN 7 126701564 missense probably damaging 1.00
IGL02380:Coro1a APN 7 126703116 nonsense probably null
coralina UTSW 7 126703049 missense probably damaging 1.00
holiday UTSW 7 126700644 splice site probably null
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0009:Coro1a UTSW 7 126701413 splice site probably benign
R0394:Coro1a UTSW 7 126700640 missense probably benign 0.01
R1275:Coro1a UTSW 7 126700583 critical splice donor site probably null
R1552:Coro1a UTSW 7 126699952 missense probably benign 0.13
R1598:Coro1a UTSW 7 126701692 missense possibly damaging 0.71
R2116:Coro1a UTSW 7 126702022 missense probably damaging 1.00
R4591:Coro1a UTSW 7 126702992 missense probably damaging 1.00
R5159:Coro1a UTSW 7 126703049 missense probably damaging 1.00
R5261:Coro1a UTSW 7 126700644 splice site probably null
R6002:Coro1a UTSW 7 126703080 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCCCTCAGACTAAGCATGGAAAC -3'
(R):5'- ACAATGTGATCCTGGTGTGGGACG -3'

Sequencing Primer
(F):5'- GAAACCCGTGGTTAGAATCTTCC -3'
(R):5'- GTGGGACGTGGGCACTG -3'
Posted On2014-04-24