Incidental Mutation 'R1618:Csnk1e'
ID174466
Institutional Source Beutler Lab
Gene Symbol Csnk1e
Ensembl Gene ENSMUSG00000022433
Gene Namecasein kinase 1, epsilon
SynonymsCKIepsilon, KC1epsilon, CKI epsilon, CK1epsilon, tau
MMRRC Submission 039655-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1618 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location79417856-79455566 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79424850 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 292 (M292K)
Ref Sequence ENSEMBL: ENSMUSP00000113975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117786] [ENSMUST00000120859] [ENSMUST00000122044] [ENSMUST00000135519] [ENSMUST00000144790] [ENSMUST00000229510] [ENSMUST00000230599] [ENSMUST00000230942]
Predicted Effect probably benign
Transcript: ENSMUST00000117786
AA Change: M292K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113341
Gene: ENSMUSG00000022433
AA Change: M292K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 8.7e-18 PFAM
Pfam:Pkinase 9 277 5.2e-28 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120859
AA Change: M292K

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113975
Gene: ENSMUSG00000022433
AA Change: M292K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 9.8e-18 PFAM
Pfam:Pkinase 9 280 7e-40 PFAM
low complexity region 306 316 N/A INTRINSIC
low complexity region 329 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122044
AA Change: M292K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113096
Gene: ENSMUSG00000022433
AA Change: M292K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 9 273 7.9e-18 PFAM
Pfam:Pkinase 9 280 5.7e-40 PFAM
low complexity region 309 324 N/A INTRINSIC
low complexity region 345 350 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127155
Predicted Effect probably benign
Transcript: ENSMUST00000135519
SMART Domains Protein: ENSMUSP00000122135
Gene: ENSMUSG00000022433

DomainStartEndE-ValueType
Pfam:Pkinase 9 118 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137028
Predicted Effect probably benign
Transcript: ENSMUST00000144790
SMART Domains Protein: ENSMUSP00000115637
Gene: ENSMUSG00000022433

DomainStartEndE-ValueType
Pfam:Pkinase 9 141 9.3e-24 PFAM
Pfam:Pkinase_Tyr 9 141 5.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156513
Predicted Effect probably benign
Transcript: ENSMUST00000229510
Predicted Effect probably benign
Transcript: ENSMUST00000230599
Predicted Effect probably benign
Transcript: ENSMUST00000230942
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.3%
  • 20x: 89.1%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit disruptions in circadian rhythms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449E01Rik T C 14: 105,498,946 noncoding transcript Het
Abca8b A T 11: 109,949,888 probably benign Het
Akp3 G A 1: 87,127,871 G547R unknown Het
Anln A G 9: 22,350,918 probably null Het
Anpep T G 7: 79,835,417 Q607P probably benign Het
Arl13b A C 16: 62,813,277 probably null Het
Asxl3 T C 18: 22,516,987 S678P probably damaging Het
Atf6b C T 17: 34,647,728 Q58* probably null Het
Camsap3 A G 8: 3,598,740 T20A possibly damaging Het
Cfap46 T A 7: 139,652,810 M782L probably benign Het
Cngb3 T C 4: 19,364,260 S155P probably benign Het
Coro1a T C 7: 126,701,547 I162V probably benign Het
Cry1 T A 10: 85,146,454 I343F probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cul9 A T 17: 46,525,892 M1069K probably benign Het
Cyp2c67 C A 19: 39,643,264 probably benign Het
Dnah11 T C 12: 118,015,465 I2633V probably damaging Het
Eif4g3 C A 4: 138,206,058 D1731E probably damaging Het
Epb41l4b T C 4: 57,032,204 T592A probably benign Het
Evi5 T C 5: 107,799,118 probably benign Het
Exo1 T A 1: 175,901,386 M672K probably benign Het
Fcho1 T C 8: 71,710,403 S661G probably damaging Het
Fnip2 A G 3: 79,508,168 Y188H possibly damaging Het
Foxb1 T C 9: 69,760,011 D79G probably damaging Het
Fyco1 T C 9: 123,829,281 Y610C probably damaging Het
Gm3095 C A 14: 3,964,571 N96K probably damaging Het
Gm3095 T A 14: 3,964,572 Y97N probably damaging Het
Gmfb A T 14: 46,811,780 L128* probably null Het
Gprc5c T A 11: 114,864,394 V299D possibly damaging Het
Hsfy2 C T 1: 56,637,229 V50I probably benign Het
Hspa12b A C 2: 131,140,929 K236Q probably benign Het
Impg2 A G 16: 56,259,858 Y566C probably damaging Het
Itpr3 A C 17: 27,116,607 probably null Het
Kprp G A 3: 92,825,476 T89I probably damaging Het
Lcmt2 T C 2: 121,138,652 E650G probably damaging Het
Lrch1 T C 14: 74,813,704 D331G probably damaging Het
Mroh9 T A 1: 163,024,541 I860F probably benign Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Myt1l A G 12: 29,827,397 D349G unknown Het
Ndufs2 T C 1: 171,246,121 T31A probably benign Het
Ndufs3 A T 2: 90,898,672 S157T probably benign Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Noct T A 3: 51,247,830 S6R probably damaging Het
Npas2 T A 1: 39,300,727 H119Q probably damaging Het
Olfr1076 T G 2: 86,508,849 L130R probably damaging Het
Olfr1206 A G 2: 88,865,527 probably null Het
Olfr138 G A 17: 38,275,666 probably null Het
Oprl1 A T 2: 181,718,853 Y207F probably benign Het
Palm3 G T 8: 84,029,662 S601I possibly damaging Het
Plscr1 T A 9: 92,266,495 C163S probably damaging Het
Ptprk A T 10: 28,493,170 M713L probably benign Het
Rdm1 A G 11: 101,628,391 D72G possibly damaging Het
Reln T C 5: 22,060,368 D442G probably benign Het
Rims4 C T 2: 163,863,929 V262M possibly damaging Het
Sbno1 T C 5: 124,404,216 Y338C probably damaging Het
Seh1l T G 18: 67,788,736 V222G probably damaging Het
Sept12 T C 16: 4,996,476 K43R probably damaging Het
Slc25a18 A C 6: 120,786,342 probably benign Het
Slc33a1 T C 3: 63,948,229 T332A possibly damaging Het
Slc35d3 A G 10: 19,849,163 S316P probably benign Het
Spata48 A G 11: 11,488,641 probably benign Het
Srrm2 T A 17: 23,818,932 probably benign Het
Srsf12 C T 4: 33,230,974 S156L probably damaging Het
Syce3 A G 15: 89,390,403 M49T probably benign Het
Tjp3 T C 10: 81,276,260 probably benign Het
Tnks G T 8: 34,875,276 N373K probably damaging Het
Togaram1 A G 12: 64,967,073 N366S possibly damaging Het
Trpm1 G A 7: 64,240,535 R962H probably damaging Het
Trpm6 A T 19: 18,877,631 M1885L possibly damaging Het
Tshz3 A G 7: 36,771,796 D1070G probably damaging Het
Ush2a T C 1: 188,814,224 M3399T probably benign Het
Utp15 G A 13: 98,257,187 T196I probably benign Het
Vmn1r168 T C 7: 23,541,300 I194T probably benign Het
Vmn2r73 C T 7: 85,875,912 W9* probably null Het
Wdr17 T C 8: 54,639,895 Y1076C probably damaging Het
Zan T C 5: 137,383,830 T5152A unknown Het
Zbtb46 A T 2: 181,424,249 V36E possibly damaging Het
Zfp558 T C 9: 18,469,283 I9M possibly damaging Het
Zscan2 T A 7: 80,875,786 Y418* probably null Het
Other mutations in Csnk1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0624:Csnk1e UTSW 15 79419898 unclassified probably benign
R1281:Csnk1e UTSW 15 79420641 missense possibly damaging 0.80
R3005:Csnk1e UTSW 15 79438805 missense probably benign 0.42
R4241:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4242:Csnk1e UTSW 15 79424895 missense probably damaging 1.00
R4276:Csnk1e UTSW 15 79429767 missense probably damaging 1.00
R4438:Csnk1e UTSW 15 79420929 missense probably benign 0.08
R4994:Csnk1e UTSW 15 79424929 missense probably damaging 1.00
R5071:Csnk1e UTSW 15 79420872 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCATTTGCCACAGGTACACAAGAG -3'
(R):5'- ACCCCAGAGAGTTCGATCAGACAG -3'

Sequencing Primer
(F):5'- ATGCCCTGTCTATGCCAAGG -3'
(R):5'- ACCTCTACTTGAAAGTGGGC -3'
Posted On2014-04-24