Incidental Mutation 'R1619:Jmjd1c'
ID174537
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
MMRRC Submission 039656-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R1619 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67219875 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 358 (V358A)
Ref Sequence ENSEMBL: ENSMUSP00000134246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
AA Change: V645A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: V645A

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173661
Predicted Effect probably benign
Transcript: ENSMUST00000173689
AA Change: V464A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876
AA Change: V464A

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174317
AA Change: V358A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876
AA Change: V358A

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174408
AA Change: V645A

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: V645A

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 A T 10: 80,009,055 H1537L probably damaging Het
Actg2 T A 6: 83,523,187 N116I probably damaging Het
Actn1 G A 12: 80,173,022 H692Y probably damaging Het
Adamts6 C T 13: 104,312,777 P36S probably benign Het
Agr3 G A 12: 35,947,859 probably null Het
Ank3 T C 10: 69,879,975 V500A probably damaging Het
BC051019 T A 7: 109,718,062 D141V probably damaging Het
Bco1 T C 8: 117,108,715 F135S probably damaging Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Ccdc42 A G 11: 68,594,289 K210E probably damaging Het
Cckar A T 5: 53,700,067 W263R probably damaging Het
Cela2a A G 4: 141,825,941 probably null Het
Cep97 A T 16: 55,927,796 N90K probably damaging Het
Ces2g A T 8: 104,967,352 Q440L probably damaging Het
Chchd6 G T 6: 89,419,754 T225K possibly damaging Het
Chd1l C T 3: 97,582,731 E503K probably benign Het
Chrna5 A G 9: 55,004,365 T46A probably benign Het
Col16a1 G A 4: 130,098,940 G1531S probably damaging Het
Col19a1 A T 1: 24,534,091 V200E unknown Het
Csf2rb A G 15: 78,335,211 D2G probably damaging Het
Csmd3 G A 15: 47,949,950 S1062L probably damaging Het
Cul5 G T 9: 53,658,593 Q113K probably benign Het
Dmwd TAGCCTGGGAA TAGCCTGGGAAGCCTGGGAA 7: 19,081,034 probably benign Het
Dse T C 10: 34,153,234 D620G probably damaging Het
Dsg1c A G 18: 20,264,842 N33S probably benign Het
Epc2 G A 2: 49,549,978 V803I probably damaging Het
Erap1 T A 13: 74,671,381 H171Q probably damaging Het
Esrrb T C 12: 86,514,500 V336A possibly damaging Het
Fech A T 18: 64,462,118 W300R probably damaging Het
Fgd4 T C 16: 16,424,056 I635V possibly damaging Het
Galc A T 12: 98,234,304 N282K probably benign Het
Gpat2 A G 2: 127,428,717 Y95C probably benign Het
Grm2 T A 9: 106,647,471 I682F probably damaging Het
Hdac10 G T 15: 89,126,675 A241D probably damaging Het
Helz T A 11: 107,636,279 C182* probably null Het
Ift140 A G 17: 25,088,865 Y978C probably damaging Het
Intu T A 3: 40,697,631 C839* probably null Het
Kif26b A G 1: 178,916,478 S1380G probably benign Het
Lrp1b A G 2: 40,697,589 S116P unknown Het
Lrrc2 T A 9: 110,960,973 S99R probably benign Het
Mrpl48 G A 7: 100,546,275 probably benign Het
Mup9 A G 4: 60,421,879 probably benign Het
Nap1l1 G A 10: 111,493,379 V285I possibly damaging Het
Nepro A G 16: 44,727,028 D36G probably benign Het
Nkain4 A G 2: 180,936,001 F187L probably damaging Het
Nobox A T 6: 43,307,467 C82S possibly damaging Het
Ntn4 C A 10: 93,644,734 Q70K probably damaging Het
Olfr1281 A G 2: 111,328,961 I181V probably benign Het
Olfr1484 T A 19: 13,585,614 F103L probably benign Het
Olfr385 A T 11: 73,589,292 W149R probably damaging Het
Olfr644 T C 7: 104,068,531 R167G probably damaging Het
Olfr71 A G 4: 43,706,292 I92T probably damaging Het
Olfr823 A G 10: 130,112,679 I37T possibly damaging Het
Pappa A G 4: 65,176,229 E497G probably damaging Het
Pard3 C A 8: 127,380,502 T569K probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pcdh10 A G 3: 45,380,312 N354D possibly damaging Het
Pdgfc T C 3: 81,174,887 V129A probably benign Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Phf20l1 A T 15: 66,615,259 H407L possibly damaging Het
Phip A T 9: 82,871,449 D1747E probably benign Het
Pkd1l1 A G 11: 8,950,413 S43P probably damaging Het
Plekhg2 T C 7: 28,368,421 E202G probably damaging Het
Rapsn A G 2: 91,043,159 D270G possibly damaging Het
Rims2 A C 15: 39,506,986 S939R probably damaging Het
Ripor3 T C 2: 167,980,845 D932G probably damaging Het
Rtp2 A T 16: 23,930,671 W30R probably damaging Het
Scgb2b27 A T 7: 34,012,132 D97E probably benign Het
Slc25a46 T C 18: 31,583,489 N320S probably benign Het
Slc9b1 A G 3: 135,355,004 probably null Het
Socs4 T A 14: 47,290,283 M225K possibly damaging Het
Spata31d1a A T 13: 59,702,433 L627* probably null Het
Srcin1 A G 11: 97,525,481 L975P probably damaging Het
Stard3 T A 11: 98,376,609 probably null Het
Susd2 G T 10: 75,638,044 S572R possibly damaging Het
Tll1 C A 8: 64,056,273 A568S probably benign Het
Tmem132a C G 19: 10,861,698 G460A probably damaging Het
Trim62 A G 4: 128,909,488 K444E probably damaging Het
Trpm3 A G 19: 22,711,907 T67A probably damaging Het
Ttc6 T C 12: 57,737,668 M1841T possibly damaging Het
Ulk2 A T 11: 61,781,746 V922D probably damaging Het
Vmn2r38 C A 7: 9,075,533 V617L probably damaging Het
Xkr6 G A 14: 63,819,317 V226M probably benign Het
Zfp940 G A 7: 29,845,537 A315V possibly damaging Het
Zfr C A 15: 12,150,387 T480K possibly damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7383:Jmjd1c UTSW 10 67189758 missense probably benign 0.14
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense probably damaging 0.99
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTTAGTGTCCAGAACACCGACACC -3'
(R):5'- TGTAGTTTCCAAAGCACTGCCTCG -3'

Sequencing Primer
(F):5'- TGCTCCTTCAGGAAGTGATAAGC -3'
(R):5'- GAGTAGGAACTGGATGGAAACTACC -3'
Posted On2014-04-24