Incidental Mutation 'R1620:0610009D07Rik'
List |< first << previous [record 11 of 386652] next >> last >|
ID174626
Institutional Source Beutler Lab
Gene Symbol 0610009D07Rik
Ensembl Gene ENSMUSG00000037361
Gene NameRIKEN cDNA 0610009D07 gene
Synonyms
MMRRC Submission
Accession Numbers
Stock #R1620 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location4817608-4827658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4826808 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 67 (I67T)
Ref Sequence ENSEMBL: ENSMUSP00000043662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046207]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046207
AA Change: I67T

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043662
Gene: ENSMUSG00000037361
AA Change: I67T

DomainStartEndE-ValueType
RRM 20 90 1.36e-16 SMART
low complexity region 104 116 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430016H08Rik T C 1: 57,409,985 probably null Het
Ac079181.2 T C 12: 115,067,875 probably benign Het
Armc2 G A 10: 41,922,296 probably benign Het
Atp2c2 T C 8: 119,749,126 V586A probably benign Het
Atp8a2 T A 14: 59,791,183 H945L probably benign Het
Bfar G T 16: 13,688,846 V187F probably damaging Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Capn13 A T 17: 73,316,308 probably benign Het
Capn2 A T 1: 182,517,137 I73N probably damaging Het
Cfc1 C A 1: 34,536,473 A76E possibly damaging Het
Chl1 T C 6: 103,690,242 F382L probably benign Het
Chst9 A G 18: 15,498,106 probably benign Het
Clec4a2 A T 6: 123,125,100 probably benign Het
Cyp2u1 A G 3: 131,302,701 S143P probably damaging Het
Dlgap4 T A 2: 156,749,136 Y764* probably null Het
Dnah10 T C 5: 124,832,643 probably benign Het
Epha4 T A 1: 77,374,926 R897S probably benign Het
Fbxl13 A T 5: 21,519,421 probably benign Het
Fscn2 A T 11: 120,366,685 T291S probably damaging Het
Gga1 G A 15: 78,888,470 S267N probably damaging Het
Gigyf2 A G 1: 87,449,128 T1287A probably damaging Het
Gm10037 T C 13: 67,842,990 probably benign Het
Gm10845 C A 14: 79,863,229 A135S unknown Het
Gm11559 T A 11: 99,865,056 L177Q unknown Het
Itga9 A G 9: 118,843,502 T781A probably benign Het
Lama1 A G 17: 67,767,033 T935A possibly damaging Het
Lrrk1 G T 7: 66,381,538 T4K probably benign Het
Lrrn1 G A 6: 107,568,366 C375Y probably damaging Het
Mecom A T 3: 29,987,088 I119N probably damaging Het
Mrpl2 G A 17: 46,647,499 R69H probably benign Het
Muc16 A G 9: 18,510,477 V26A probably benign Het
Myh3 C T 11: 67,088,736 probably benign Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Myot A T 18: 44,337,058 Q34L possibly damaging Het
Nlrp5 A G 7: 23,418,639 D596G probably damaging Het
Nomo1 A G 7: 46,078,151 probably benign Het
Npas2 T C 1: 39,333,912 S415P possibly damaging Het
Obox2 A G 7: 15,397,041 E66G probably benign Het
Olfr1312 G T 2: 112,042,246 T262K probably benign Het
Otog G A 7: 46,249,124 probably benign Het
Pcdh9 G A 14: 93,888,305 P143L probably damaging Het
Phactr1 G T 13: 43,094,897 V448L probably benign Het
Pparg A T 6: 115,473,281 I414L probably benign Het
Rapgef6 A T 11: 54,626,594 I371L possibly damaging Het
Rc3h1 T C 1: 160,954,973 V674A probably benign Het
Rps6ka4 T C 19: 6,838,149 Y159C probably damaging Het
Scn3a C T 2: 65,529,375 probably benign Het
Spata17 T C 1: 187,183,215 probably benign Het
Ston1 A G 17: 88,635,816 T217A probably benign Het
Tank A G 2: 61,650,098 D327G possibly damaging Het
Tbc1d9 T A 8: 83,249,595 N594K probably damaging Het
Tfpi2 T A 6: 3,965,507 T102S probably benign Het
Txnrd1 C T 10: 82,884,015 probably benign Het
Ulk4 T G 9: 121,204,805 E589D possibly damaging Het
Usp40 A T 1: 87,994,225 H305Q probably damaging Het
Vmn1r170 A G 7: 23,606,329 K52R probably benign Het
Vmn1r194 A G 13: 22,244,963 D250G probably damaging Het
Wdr6 A T 9: 108,574,655 D676E possibly damaging Het
Xirp2 T A 2: 67,510,835 V1140E probably damaging Het
Other mutations in 0610009D07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
X0024:0610009D07Rik UTSW 12 4820718 splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- ACCGAGAGCCTTCATCGGCATTAC -3'
(R):5'- CCACAGTTAACGGGACTGAGCTAC -3'

Sequencing Primer
(F):5'- GTCTCCAATCAGTTCTTACAGGG -3'
(R):5'- GGACTGAGCTACACAGCC -3'
Posted OnApr 24, 2014