Incidental Mutation 'R1621:Snx7'
ID174650
Institutional Source Beutler Lab
Gene Symbol Snx7
Ensembl Gene ENSMUSG00000028007
Gene Namesorting nexin 7
Synonyms
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location117781647-117868936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117837156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 185 (I185V)
Ref Sequence ENSEMBL: ENSMUSP00000125804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029639] [ENSMUST00000167877] [ENSMUST00000198499]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029639
AA Change: I268V

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029639
Gene: ENSMUSG00000028007
AA Change: I268V

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
PX 85 205 1.55e-22 SMART
coiled coil region 362 391 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167877
AA Change: I185V

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125804
Gene: ENSMUSG00000028007
AA Change: I185V

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
PX 57 196 3.62e-2 SMART
coiled coil region 279 308 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169812
AA Change: I259V
SMART Domains Protein: ENSMUSP00000128007
Gene: ENSMUSG00000028007
AA Change: I259V

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
PX 77 197 1.55e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198499
AA Change: I210V

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000143230
Gene: ENSMUSG00000028007
AA Change: I210V

DomainStartEndE-ValueType
PX 27 147 1.55e-22 SMART
coiled coil region 304 333 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein does not contain a coiled coil region like some family members, and its exact function is unknown. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Snx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Snx7 APN 3 117839960 missense probably damaging 1.00
IGL02859:Snx7 APN 3 117829671 splice site probably benign
IGL03260:Snx7 APN 3 117782293 utr 3 prime probably benign
IGL03357:Snx7 APN 3 117838875 missense probably damaging 1.00
P0026:Snx7 UTSW 3 117840023 missense probably damaging 1.00
R0620:Snx7 UTSW 3 117846675 missense probably damaging 0.96
R0731:Snx7 UTSW 3 117829671 splice site probably benign
R1613:Snx7 UTSW 3 117829573 splice site probably benign
R1911:Snx7 UTSW 3 117829668 splice site probably null
R1912:Snx7 UTSW 3 117829668 splice site probably null
R3788:Snx7 UTSW 3 117838990 splice site probably benign
R4663:Snx7 UTSW 3 117800879 missense probably benign 0.00
R5182:Snx7 UTSW 3 117832857 missense probably damaging 1.00
R5681:Snx7 UTSW 3 117846623 missense probably benign 0.10
R6397:Snx7 UTSW 3 117846623 missense probably benign 0.10
R6715:Snx7 UTSW 3 117782336 missense possibly damaging 0.47
R6901:Snx7 UTSW 3 117829636 nonsense probably null
R6996:Snx7 UTSW 3 117846632 missense possibly damaging 0.82
R7049:Snx7 UTSW 3 117840031 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTCTCTGTGTGAGCGGGTGC -3'
(R):5'- GCTTGCTGAGCAGGATGGGAC -3'

Sequencing Primer
(F):5'- tgtaggtgtggggtggag -3'
(R):5'- CAGACAGTCCGAGCAGTG -3'
Posted On2014-04-24