Incidental Mutation 'R1621:Actl6b'
ID174660
Institutional Source Beutler Lab
Gene Symbol Actl6b
Ensembl Gene ENSMUSG00000029712
Gene Nameactin-like 6B
SynonymsActl6, ArpNa, Baf53b
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.731) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location137553517-137569582 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137565779 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 253 (N253S)
Ref Sequence ENSEMBL: ENSMUSP00000031725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031725] [ENSMUST00000031729] [ENSMUST00000136088] [ENSMUST00000136565] [ENSMUST00000139395] [ENSMUST00000196471] [ENSMUST00000198601] [ENSMUST00000198866] [ENSMUST00000199054]
Predicted Effect probably benign
Transcript: ENSMUST00000031725
AA Change: N253S

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031725
Gene: ENSMUSG00000029712
AA Change: N253S

DomainStartEndE-ValueType
ACTIN 11 379 4.16e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000031729
SMART Domains Protein: ENSMUSP00000031729
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 235 326 2.2e-12 PFAM
Pfam:Peptidase_M28 407 618 2.9e-16 PFAM
Pfam:TFR_dimer 664 788 5.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136088
SMART Domains Protein: ENSMUSP00000117138
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
Pfam:Actin 1 75 4.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136565
SMART Domains Protein: ENSMUSP00000117425
Gene: ENSMUSG00000029712

DomainStartEndE-ValueType
Pfam:Actin 1 116 1.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139395
AA Change: N253S

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119356
Gene: ENSMUSG00000029712
AA Change: N253S

DomainStartEndE-ValueType
ACTIN 11 426 5.96e-167 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196471
SMART Domains Protein: ENSMUSP00000142814
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198601
Predicted Effect probably benign
Transcript: ENSMUST00000198866
SMART Domains Protein: ENSMUSP00000142720
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199054
SMART Domains Protein: ENSMUSP00000142478
Gene: ENSMUSG00000029716

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Pfam:PA 231 328 1.3e-12 PFAM
Pfam:Peptidase_M28 418 606 7.5e-15 PFAM
low complexity region 612 625 N/A INTRINSIC
Pfam:TFR_dimer 663 790 1.8e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200190
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of actin-related proteins (ARPs) which share significant amino acid sequence identity to conventional actins. Both actins and ARPs have an actin fold, which is an ATP-binding cleft, as a common feature. The ARPs are involved in diverse cellular processes, including vesicular transport, spindle orientation, nuclear migration and chromatin remodeling. This gene encodes a subunit of the BAF (BRG1/brm-associated factor) complex in mammals, which is functionally related to SWI/SNF complex in S. cerevisiae and Drosophila; the latter is thought to facilitate transcriptional activation of specific genes by antagonizing chromatin-mediated transcriptional repression. This subunit may be involved in the regulation of genes by structural modulation of their chromatin, specifically in the brain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for null mutations exhibit low survivor rate and most die within 2 days after birth and show hyperactivity due to reduced dendrite formation in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Actl6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Actl6b APN 5 137554637 missense probably damaging 0.99
IGL03271:Actl6b APN 5 137565984 missense probably damaging 1.00
R0128:Actl6b UTSW 5 137555065 missense probably benign
R0254:Actl6b UTSW 5 137554144 intron probably benign
R0571:Actl6b UTSW 5 137566784 unclassified probably benign
R1438:Actl6b UTSW 5 137554609 missense probably damaging 0.99
R1530:Actl6b UTSW 5 137569378 missense probably damaging 1.00
R2008:Actl6b UTSW 5 137569330 missense probably damaging 1.00
R2907:Actl6b UTSW 5 137567297 missense probably damaging 1.00
R3826:Actl6b UTSW 5 137567273 missense probably damaging 0.99
R5326:Actl6b UTSW 5 137567051 missense probably damaging 1.00
R5763:Actl6b UTSW 5 137566801 missense possibly damaging 0.49
R5906:Actl6b UTSW 5 137567329 missense possibly damaging 0.95
R5972:Actl6b UTSW 5 137566556 missense possibly damaging 0.55
R6709:Actl6b UTSW 5 137554517 missense possibly damaging 0.91
R7134:Actl6b UTSW 5 137564500 missense not run
X0065:Actl6b UTSW 5 137565737 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGGCTGACAAGCCACTCTATCTCC -3'
(R):5'- GCCCAACTCACTGTTCATCGTAAGG -3'

Sequencing Primer
(F):5'- CAGAGCAGAATCTCAGGGCTG -3'
(R):5'- CACTGTTCATCGTAAGGGGAATC -3'
Posted On2014-04-24