Incidental Mutation 'R1621:Olfr373'
ID174662
Institutional Source Beutler Lab
Gene Symbol Olfr373
Ensembl Gene ENSMUSG00000061561
Gene Nameolfactory receptor 373
SynonymsMOR282-2, GA_x6K02T2NUPS-231686-232630, MOR282-1
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location72083177-72103084 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72100129 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 123 (Y123C)
Ref Sequence ENSEMBL: ENSMUSP00000149452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074540] [ENSMUST00000213940] [ENSMUST00000215198]
Predicted Effect probably damaging
Transcript: ENSMUST00000074540
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074128
Gene: ENSMUSG00000061561
AA Change: Y123C

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 6.1e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 253 6.5e-8 PFAM
Pfam:7tm_1 41 290 4.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213940
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215198
AA Change: Y123C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Olfr373
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Olfr373 APN 8 72100512 missense probably damaging 1.00
IGL02440:Olfr373 APN 8 72100530 missense probably damaging 1.00
IGL03403:Olfr373 APN 8 72100497 missense probably benign 0.00
R1099:Olfr373 UTSW 8 72100659 missense probably benign 0.00
R1418:Olfr373 UTSW 8 72100387 missense probably damaging 1.00
R1452:Olfr373 UTSW 8 72100176 nonsense probably null
R2021:Olfr373 UTSW 8 72100086 missense possibly damaging 0.90
R4230:Olfr373 UTSW 8 72100344 missense probably damaging 1.00
R4290:Olfr373 UTSW 8 72099768 missense probably benign
R5035:Olfr373 UTSW 8 72100078 missense probably damaging 1.00
R6884:Olfr373 UTSW 8 72100501 missense probably benign 0.26
R6909:Olfr373 UTSW 8 72100528 missense possibly damaging 0.95
Z1088:Olfr373 UTSW 8 72100517 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATCATTGGCCTGCTAGGCAAC -3'
(R):5'- CATCTCACAGAAGAAGTGGTCCACG -3'

Sequencing Primer
(F):5'- TGATTGCCACAGACTCCAGG -3'
(R):5'- TCCACGGTGTGTGAGGC -3'
Posted On2014-04-24