Incidental Mutation 'R1621:Pmfbp1'
ID174664
Institutional Source Beutler Lab
Gene Symbol Pmfbp1
Ensembl Gene ENSMUSG00000031727
Gene Namepolyamine modulated factor 1 binding protein 1
SynonymsF77, 1700016D22Rik
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R1621 (G1)
Quality Score135
Status Not validated
Chromosome8
Chromosomal Location109494027-109542640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109499538 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 69 (H69R)
Ref Sequence ENSEMBL: ENSMUSP00000034162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034162]
Predicted Effect probably benign
Transcript: ENSMUST00000034162
AA Change: H69R

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034162
Gene: ENSMUSG00000031727
AA Change: H69R

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
internal_repeat_1 38 84 9.43e-6 PROSPERO
coiled coil region 89 121 N/A INTRINSIC
internal_repeat_1 138 178 9.43e-6 PROSPERO
coiled coil region 197 223 N/A INTRINSIC
coiled coil region 334 377 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
coiled coil region 411 732 N/A INTRINSIC
coiled coil region 758 879 N/A INTRINSIC
coiled coil region 931 968 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212003
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Pmfbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Pmfbp1 APN 8 109537993 missense possibly damaging 0.75
IGL01505:Pmfbp1 APN 8 109513911 missense probably damaging 1.00
IGL01609:Pmfbp1 APN 8 109527716 missense probably benign 0.12
IGL02066:Pmfbp1 APN 8 109541733 missense possibly damaging 0.76
IGL02926:Pmfbp1 APN 8 109520249 missense probably damaging 1.00
IGL03374:Pmfbp1 APN 8 109542414 utr 3 prime probably benign
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0022:Pmfbp1 UTSW 8 109525407 missense probably damaging 1.00
R0046:Pmfbp1 UTSW 8 109535985 splice site probably benign
R0068:Pmfbp1 UTSW 8 109542379 splice site probably benign
R0211:Pmfbp1 UTSW 8 109541740 missense probably benign 0.03
R0244:Pmfbp1 UTSW 8 109541673 missense probably damaging 1.00
R0468:Pmfbp1 UTSW 8 109513968 splice site probably null
R0479:Pmfbp1 UTSW 8 109530473 splice site probably benign
R1124:Pmfbp1 UTSW 8 109530483 critical splice acceptor site probably null
R1332:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1336:Pmfbp1 UTSW 8 109530266 missense probably damaging 1.00
R1961:Pmfbp1 UTSW 8 109530144 splice site probably benign
R2069:Pmfbp1 UTSW 8 109532103 missense possibly damaging 0.68
R2125:Pmfbp1 UTSW 8 109520273 missense probably damaging 1.00
R2889:Pmfbp1 UTSW 8 109525431 missense probably damaging 0.99
R3034:Pmfbp1 UTSW 8 109520921 critical splice acceptor site probably null
R3956:Pmfbp1 UTSW 8 109530169 missense probably benign 0.25
R4085:Pmfbp1 UTSW 8 109494947 missense possibly damaging 0.92
R4191:Pmfbp1 UTSW 8 109527628 missense probably benign 0.00
R4410:Pmfbp1 UTSW 8 109532063 missense probably benign 0.07
R4418:Pmfbp1 UTSW 8 109530633 missense probably benign 0.36
R4888:Pmfbp1 UTSW 8 109532160 missense probably damaging 1.00
R4937:Pmfbp1 UTSW 8 109535866 missense probably benign
R5070:Pmfbp1 UTSW 8 109530155 missense probably damaging 0.99
R5184:Pmfbp1 UTSW 8 109527767 missense possibly damaging 0.92
R5552:Pmfbp1 UTSW 8 109531751 missense probably damaging 0.98
R5609:Pmfbp1 UTSW 8 109525107 missense probably damaging 1.00
R5760:Pmfbp1 UTSW 8 109521023 missense probably damaging 0.99
R5818:Pmfbp1 UTSW 8 109538679 splice site probably null
R6378:Pmfbp1 UTSW 8 109530266 missense probably damaging 0.99
R6496:Pmfbp1 UTSW 8 109532157 missense probably null 0.04
R6550:Pmfbp1 UTSW 8 109520207 missense possibly damaging 0.90
R6565:Pmfbp1 UTSW 8 109525428 nonsense probably null
R6624:Pmfbp1 UTSW 8 109530190 missense possibly damaging 0.92
R6684:Pmfbp1 UTSW 8 109535830 missense probably benign 0.10
R6823:Pmfbp1 UTSW 8 109530307 missense possibly damaging 0.92
R6833:Pmfbp1 UTSW 8 109538675 critical splice donor site probably null
R6940:Pmfbp1 UTSW 8 109525191 missense probably damaging 0.98
R7000:Pmfbp1 UTSW 8 109530589 missense possibly damaging 0.92
X0065:Pmfbp1 UTSW 8 109535867 missense probably benign 0.25
Z1088:Pmfbp1 UTSW 8 109513944 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAATTTCCAGCGAATTCAGCTCCC -3'
(R):5'- GGTGATACGCAGTATCTCGATGACG -3'

Sequencing Primer
(F):5'- CTGTCAGCCCGTTAAGTGAAG -3'
(R):5'- TATCTCGATGACGGTAGAAATGGC -3'
Posted On2014-04-24