Incidental Mutation 'R1621:Irgm2'
ID174669
Institutional Source Beutler Lab
Gene Symbol Irgm2
Ensembl Gene ENSMUSG00000069874
Gene Nameimmunity-related GTPase family M member 2
SynonymsGtpi, Iigp2
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location58199618-58222782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58220538 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 364 (F364L)
Ref Sequence ENSEMBL: ENSMUSP00000146805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058704] [ENSMUST00000108836] [ENSMUST00000209079]
Predicted Effect probably benign
Transcript: ENSMUST00000058704
AA Change: F352L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056001
Gene: ENSMUSG00000069874
AA Change: F352L

DomainStartEndE-ValueType
Pfam:IIGP 30 387 8.1e-165 PFAM
Pfam:MMR_HSR1 66 179 9.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108836
AA Change: F352L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104464
Gene: ENSMUSG00000069874
AA Change: F352L

DomainStartEndE-ValueType
Pfam:IIGP 30 387 4.9e-164 PFAM
Pfam:MMR_HSR1 66 179 2.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209079
AA Change: F364L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the p47 immunity-related GTPase family. The encoded protein may play a role in the innate immune response by regulating autophagy formation in response to intracellular pathogens. Polymorphisms that affect the normal expression of this gene are associated with a susceptibility to Crohn's disease and tuberculosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Irgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Irgm2 APN 11 58220341 missense probably benign 0.00
IGL01933:Irgm2 APN 11 58219957 missense possibly damaging 0.95
IGL02115:Irgm2 APN 11 58220122 missense probably benign 0.21
IGL02398:Irgm2 APN 11 58219929 missense probably damaging 1.00
IGL02708:Irgm2 APN 11 58220524 missense probably benign 0.00
IGL02730:Irgm2 APN 11 58219990 missense probably benign 0.26
R0282:Irgm2 UTSW 11 58219519 missense probably benign 0.00
R1717:Irgm2 UTSW 11 58220635 missense probably damaging 1.00
R1980:Irgm2 UTSW 11 58220076 missense probably damaging 0.99
R1986:Irgm2 UTSW 11 58219558 missense probably benign 0.00
R2145:Irgm2 UTSW 11 58220529 missense possibly damaging 0.90
R2184:Irgm2 UTSW 11 58220428 missense probably benign 0.01
R2327:Irgm2 UTSW 11 58220392 missense probably damaging 1.00
R4041:Irgm2 UTSW 11 58220130 missense probably benign 0.00
R4231:Irgm2 UTSW 11 58219478 start gained probably benign
R5988:Irgm2 UTSW 11 58220187 missense probably benign 0.39
R6143:Irgm2 UTSW 11 58220609 missense possibly damaging 0.55
R6508:Irgm2 UTSW 11 58219501 missense probably benign
R6528:Irgm2 UTSW 11 58220052 missense probably benign 0.10
R6851:Irgm2 UTSW 11 58219815 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTCGTCGAAACCCTTTACCAAGTC -3'
(R):5'- AGTCGGCCTAGTAACCTCAAGGAAC -3'

Sequencing Primer
(F):5'- GATAACCTACACACAGAGTTTGG -3'
(R):5'- GTTATCTCAACTGGGGGTACAC -3'
Posted On2014-04-24