Incidental Mutation 'R1621:Top3a'
ID174670
Institutional Source Beutler Lab
Gene Symbol Top3a
Ensembl Gene ENSMUSG00000002814
Gene Nametopoisomerase (DNA) III alpha
SynonymsTop IIIa
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60740058-60777365 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60750607 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 392 (I392N)
Ref Sequence ENSEMBL: ENSMUSP00000113653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002891] [ENSMUST00000102668] [ENSMUST00000117743] [ENSMUST00000120417]
Predicted Effect probably damaging
Transcript: ENSMUST00000002891
AA Change: I417N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002891
Gene: ENSMUSG00000002814
AA Change: I417N

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 1.7e-15 PFAM
Pfam:zf-GRF 813 854 9.7e-23 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 7.9e-24 PFAM
ZnF_C2HC 985 1001 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102668
AA Change: I417N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099729
Gene: ENSMUSG00000002814
AA Change: I417N

DomainStartEndE-ValueType
TOPRIM 35 169 5.04e-24 SMART
TOP1Bc 172 269 4.99e-37 SMART
TOP1Ac 315 569 1.47e-107 SMART
Pfam:zf-C4_Topoisom 655 694 5.9e-16 PFAM
Pfam:zf-GRF 813 854 2.6e-21 PFAM
low complexity region 884 896 N/A INTRINSIC
Pfam:zf-GRF 897 941 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117743
AA Change: I392N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113057
Gene: ENSMUSG00000002814
AA Change: I392N

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 669 4.6e-16 PFAM
ZnF_C2HC 755 771 7.06e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120417
AA Change: I392N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113653
Gene: ENSMUSG00000002814
AA Change: I392N

DomainStartEndE-ValueType
TOPRIM 10 144 5.04e-24 SMART
TOP1Bc 147 244 4.99e-37 SMART
TOP1Ac 290 544 1.47e-107 SMART
Pfam:zf-C4_Topoisom 630 666 1.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124799
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus reducing the number of supercoils and altering the topology of DNA. This enzyme forms a complex with BLM which functions in the regulation of recombination in somatic cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null allele die shortly after implantation and the induction of decidual reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Top3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Top3a APN 11 60761736 missense probably damaging 1.00
IGL02935:Top3a APN 11 60762528 missense possibly damaging 0.53
R0057:Top3a UTSW 11 60740684 missense probably benign
R0057:Top3a UTSW 11 60740684 missense probably benign
R0369:Top3a UTSW 11 60742789 missense probably damaging 1.00
R1171:Top3a UTSW 11 60750593 missense probably benign 0.02
R1459:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1812:Top3a UTSW 11 60759362 missense probably damaging 1.00
R1839:Top3a UTSW 11 60753888 missense probably damaging 1.00
R1873:Top3a UTSW 11 60747984 nonsense probably null
R2004:Top3a UTSW 11 60742489 missense probably damaging 0.99
R2277:Top3a UTSW 11 60745874 missense possibly damaging 0.95
R2406:Top3a UTSW 11 60756012 missense probably damaging 1.00
R2418:Top3a UTSW 11 60748016 missense possibly damaging 0.95
R3196:Top3a UTSW 11 60759356 missense probably damaging 1.00
R3879:Top3a UTSW 11 60743939 missense possibly damaging 0.92
R4695:Top3a UTSW 11 60742412 missense probably benign 0.40
R4715:Top3a UTSW 11 60742997 nonsense probably null
R4768:Top3a UTSW 11 60762490 missense probably damaging 1.00
R4910:Top3a UTSW 11 60752378 splice site probably benign
R5305:Top3a UTSW 11 60762539 missense possibly damaging 0.56
R5387:Top3a UTSW 11 60762490 missense probably damaging 1.00
R5419:Top3a UTSW 11 60762522 missense probably damaging 1.00
R5806:Top3a UTSW 11 60776920 critical splice donor site probably null
R6162:Top3a UTSW 11 60745937 missense probably damaging 1.00
R6279:Top3a UTSW 11 60749408 missense probably benign 0.02
R6300:Top3a UTSW 11 60749408 missense probably benign 0.02
R6381:Top3a UTSW 11 60744023 missense probably damaging 1.00
R6383:Top3a UTSW 11 60749459 missense probably benign 0.30
R6767:Top3a UTSW 11 60750753 missense possibly damaging 0.84
R6919:Top3a UTSW 11 60749493 missense probably damaging 1.00
X0063:Top3a UTSW 11 60750644 nonsense probably null
X0065:Top3a UTSW 11 60763398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTTGTACTCAGGCACCTGCAC -3'
(R):5'- GGAAAGCCTAATGCTTCTGACCCC -3'

Sequencing Primer
(F):5'- cgcacacccaatcccag -3'
(R):5'- AAGCCTAACAATGCCCTTTTGG -3'
Posted On2014-04-24