Incidental Mutation 'R1621:Ctns'
ID174672
Institutional Source Beutler Lab
Gene Symbol Ctns
Ensembl Gene ENSMUSG00000005949
Gene Namecystinosis, nephropathic
Synonyms
MMRRC Submission 039658-MU
Accession Numbers

NCBI RefSeq: NM_031251; MGI: 1932872

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location73183596-73199042 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73188472 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 140 (V140A)
Ref Sequence ENSEMBL: ENSMUSP00000104116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006103] [ENSMUST00000108476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006103
AA Change: V140A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006103
Gene: ENSMUSG00000005949
AA Change: V140A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108476
AA Change: V140A

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104116
Gene: ENSMUSG00000005949
AA Change: V140A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CTNS 140 171 6.43e-12 SMART
transmembrane domain 206 225 N/A INTRINSIC
transmembrane domain 238 257 N/A INTRINSIC
CTNS 279 310 1.47e-6 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144658
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150468
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype Strain: MGI:2388945
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a seven-transmembrane domain protein that functions to transport cystine out of lysosomes. Its activity is driven by the H+ electrochemical gradient of the lysosomal membrane. Mutations in this gene cause cystinosis, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased intracellular cystine, progressive accumulation of cystine crystals, occasional muscle impairment, reduced exploratory activity, osteoporosis, and lowered electroretinogram amplitude. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Ctns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ctns APN 11 73188722 missense possibly damaging 0.88
IGL02582:Ctns APN 11 73196652 missense probably benign 0.22
R0103:Ctns UTSW 11 73185311 missense probably damaging 1.00
R1125:Ctns UTSW 11 73187837 critical splice acceptor site probably null
R1333:Ctns UTSW 11 73184997 missense probably benign 0.03
R1422:Ctns UTSW 11 73185246 missense probably damaging 1.00
R2104:Ctns UTSW 11 73193081 missense probably benign 0.07
R2427:Ctns UTSW 11 73196686 missense probably damaging 1.00
R4096:Ctns UTSW 11 73186386 missense probably benign 0.11
R4946:Ctns UTSW 11 73196653 missense probably benign
R6220:Ctns UTSW 11 73193128 missense probably benign 0.00
R6307:Ctns UTSW 11 73191733 missense probably benign 0.26
R6744:Ctns UTSW 11 73185285 missense probably damaging 1.00
R7064:Ctns UTSW 11 73186392 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ACCCAAGACCCTTGTGGCAATG -3'
(R):5'- ATGGGGACTTCCTCCCAAACCTTC -3'

Sequencing Primer
(F):5'- CCCTTGTGGCAATGTGAAGAC -3'
(R):5'- CCTTCACCAAATGCATCCTG -3'
Posted On2014-04-24