Incidental Mutation 'R1621:Ippk'
ID174677
Institutional Source Beutler Lab
Gene Symbol Ippk
Ensembl Gene ENSMUSG00000021385
Gene Nameinositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms1810043M15Rik
MMRRC Submission 039658-MU
Accession Numbers

Genbank: NM_199056.2; Ensembl: ENSMUST00000021817

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location49421249-49464573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49461568 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 427 (S427P)
Ref Sequence ENSEMBL: ENSMUSP00000152331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021817] [ENSMUST00000021818] [ENSMUST00000220447] [ENSMUST00000220856]
Predicted Effect probably benign
Transcript: ENSMUST00000021817
AA Change: S476P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000021817
Gene: ENSMUSG00000021385
AA Change: S476P

DomainStartEndE-ValueType
Pfam:Ins_P5_2-kin 13 455 1.9e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220447
AA Change: S427P

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000220856
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinase that phosphorylates position 2 of inositol-1,3,4,5,6-pentakisphosphate to form inositol-1,2,3,4,5,6-hexakisphosphate (InsP6). InsP6 has a variety of functions, including stimulation of DNA repair, endocytosis, and mRNA export. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a gene trap insertion die prior to E8.5. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(6)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Map3k11 A G 19: 5,690,806 E187G probably damaging Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Ippk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Ippk APN 13 49449264 missense probably damaging 1.00
IGL01994:Ippk APN 13 49458617 missense possibly damaging 0.94
IGL02165:Ippk APN 13 49446535 missense possibly damaging 0.78
IGL02577:Ippk APN 13 49461658 missense possibly damaging 0.86
IGL03181:Ippk APN 13 49441987 missense probably damaging 1.00
1mM(1):Ippk UTSW 13 49435491 missense probably damaging 1.00
R0467:Ippk UTSW 13 49430865 splice site probably null
R0811:Ippk UTSW 13 49443471 missense probably damaging 1.00
R0812:Ippk UTSW 13 49443471 missense probably damaging 1.00
R1491:Ippk UTSW 13 49461593 missense probably benign 0.16
R1930:Ippk UTSW 13 49450018 missense probably damaging 1.00
R4081:Ippk UTSW 13 49446376 missense probably damaging 1.00
R5815:Ippk UTSW 13 49446363 missense probably damaging 1.00
R7069:Ippk UTSW 13 49461743 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCTATGGCATAGCAGTCACTTACC -3'
(R):5'- AGTTTCAAAGACACCGCAGGGG -3'

Sequencing Primer
(F):5'- ATAGCAGTCACTTACCTGTGC -3'
(R):5'- GACCTTATGGAGAACTAATGTGC -3'
Posted On2014-04-24