Incidental Mutation 'R1621:Map3k11'
ID174683
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
MMRRC Submission 039658-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R1621 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5690806 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 187 (E187G)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156] [ENSMUST00000068169] [ENSMUST00000113615]
Predicted Effect probably damaging
Transcript: ENSMUST00000004156
AA Change: E187G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: E187G

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068169
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113615
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.0%
  • 20x: 84.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl6b A G 5: 137,565,779 N253S probably benign Het
Adamts3 G A 5: 89,721,701 H272Y probably damaging Het
Arpc5l T C 2: 39,013,901 probably null Het
Birc6 G A 17: 74,670,250 V4333I probably benign Het
Cd38 A G 5: 43,901,524 D160G probably benign Het
Cdc7 A G 5: 106,965,054 S13G probably benign Het
Chrm5 G T 2: 112,479,837 D311E probably benign Het
Ctns A G 11: 73,188,472 V140A possibly damaging Het
Ets2 A G 16: 95,709,869 D57G probably damaging Het
Fbxo36 T A 1: 84,839,874 M1K probably null Het
Fhod3 T A 18: 25,022,867 I514K probably benign Het
G3bp2 A T 5: 92,056,278 F350I probably damaging Het
Hs3st3a1 G T 11: 64,436,223 V53F probably benign Het
Ippk T C 13: 49,461,568 S427P probably benign Het
Irgm2 T C 11: 58,220,538 F364L probably benign Het
Lipn A G 19: 34,068,713 K29E probably benign Het
Nrxn3 A G 12: 88,795,710 M176V probably benign Het
Olfr373 A G 8: 72,100,129 Y123C probably damaging Het
Palm3 G A 8: 84,030,022 S721N possibly damaging Het
Plxnb1 A G 9: 109,106,805 I1088V probably benign Het
Pmfbp1 A G 8: 109,499,538 H69R probably benign Het
Pou2af1 C T 9: 51,232,860 H54Y probably damaging Het
Prl6a1 C T 13: 27,318,010 T120I probably benign Het
Psen2 A T 1: 180,229,465 F331L probably benign Het
Pygl T C 12: 70,191,092 D724G probably damaging Het
Slc25a48 T A 13: 56,470,470 *307R probably null Het
Slc39a6 T C 18: 24,600,889 K248E probably benign Het
Slco4a1 A T 2: 180,471,132 T386S probably benign Het
Snx7 T C 3: 117,837,156 I185V possibly damaging Het
Tmem94 A G 11: 115,785,845 S59G probably benign Het
Top3a A T 11: 60,750,607 I392N probably damaging Het
Utp20 A G 10: 88,762,871 I81T probably benign Het
Utrn A G 10: 12,713,283 L893S probably benign Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1736:Map3k11 UTSW 19 5697401 missense probably benign 0.34
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3836:Map3k11 UTSW 19 5690803 missense possibly damaging 0.71
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4513:Map3k11 UTSW 19 5702210 missense probably damaging 0.97
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5372:Map3k11 UTSW 19 5690962 missense probably damaging 1.00
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6052:Map3k11 UTSW 19 5697402 missense probably benign 0.01
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGCAGCTTATGCCAATCCTGTC -3'
(R):5'- TGCTTCATGCCCCTGGAAACTCAC -3'

Sequencing Primer
(F):5'- TTCGACTATGAGCCCAATGG -3'
(R):5'- GAAACTCACTGTTGTTGGACTTC -3'
Posted On2014-04-24