Incidental Mutation 'R1622:Pank2'
ID174691
Institutional Source Beutler Lab
Gene Symbol Pank2
Ensembl Gene ENSMUSG00000037514
Gene Namepantothenate kinase 2
Synonyms4933409I19Rik
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1622 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131262495-131299188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 131273969 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 102 (E102D)
Ref Sequence ENSEMBL: ENSMUSP00000138992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000150843] [ENSMUST00000184105] [ENSMUST00000184932]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138509
Predicted Effect unknown
Transcript: ENSMUST00000145904
AA Change: E26D
SMART Domains Protein: ENSMUSP00000115034
Gene: ENSMUSG00000037514
AA Change: E26D

DomainStartEndE-ValueType
Pfam:Fumble 11 128 5.1e-21 PFAM
Pfam:Fumble 121 178 2.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150843
AA Change: E102D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514
AA Change: E102D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183349
Predicted Effect probably benign
Transcript: ENSMUST00000183388
Predicted Effect probably damaging
Transcript: ENSMUST00000184105
AA Change: E102D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138992
Gene: ENSMUSG00000037514
AA Change: E102D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 154 7.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184932
AA Change: E102D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514
AA Change: E102D

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the pantothenate kinase family and is the only member of that family to be expressed in mitochondria. Pantothenate kinase is a key regulatory enzyme in the biosynthesis of coenzyme A (CoA) in bacteria and mammalian cells. It catalyzes the first committed step in the universal biosynthetic pathway leading to CoA and is itself subject to regulation through feedback inhibition by acyl CoA species. Mutations in this gene are associated with HARP syndrome and pantothenate kinase-associated neurodegeneration (PKAN), formerly Hallervorden-Spatz syndrome. Alternative splicing, involving the use of alternate first exons, results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male infertility, arrested spermatogenesis, azoospermia, reduced female fertility, and retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nfatc1 A G 18: 80,666,967 M514T probably damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Pank2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Pank2 APN 2 131274169 missense possibly damaging 0.69
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0242:Pank2 UTSW 2 131280197 missense probably damaging 1.00
R0492:Pank2 UTSW 2 131280260 missense probably damaging 1.00
R0513:Pank2 UTSW 2 131282606 missense probably damaging 1.00
R1415:Pank2 UTSW 2 131282718 nonsense probably null
R2217:Pank2 UTSW 2 131282681 intron probably null
R4690:Pank2 UTSW 2 131274025 missense probably damaging 1.00
R4691:Pank2 UTSW 2 131296281 missense possibly damaging 0.85
R5387:Pank2 UTSW 2 131274262 missense probably benign 0.24
R6175:Pank2 UTSW 2 131280261 nonsense probably null
R6806:Pank2 UTSW 2 131262707 unclassified probably benign
R6848:Pank2 UTSW 2 131282626 missense probably damaging 0.98
R7010:Pank2 UTSW 2 131280373 missense probably benign
R7467:Pank2 UTSW 2 131274047 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGCACGTTAGGGTGAGTCCTAGAG -3'
(R):5'- TTTGCGTCCACACAGAGTCAGGTC -3'

Sequencing Primer
(F):5'- tatccacccacccccac -3'
(R):5'- AGTCAGGTCCTTCAGCTCAAG -3'
Posted On2014-04-24