Incidental Mutation 'R1622:Nfatc1'
ID174740
Institutional Source Beutler Lab
Gene Symbol Nfatc1
Ensembl Gene ENSMUSG00000033016
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1
SynonymsNFATc, NFAT2, 2210017P03Rik, NF-ATc
MMRRC Submission 039659-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1622 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location80606205-80713071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80666967 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 514 (M514T)
Ref Sequence ENSEMBL: ENSMUSP00000126884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035800] [ENSMUST00000078049] [ENSMUST00000167977] [ENSMUST00000170905]
Predicted Effect probably damaging
Transcript: ENSMUST00000035800
AA Change: M514T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046312
Gene: ENSMUSG00000033016
AA Change: M514T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 7.4e-28 PFAM
IPT 582 681 8.99e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078049
AA Change: M528T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077196
Gene: ENSMUSG00000033016
AA Change: M528T

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD 429 589 1.3e-27 PFAM
IPT 596 695 8.99e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167977
AA Change: M514T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126884
Gene: ENSMUSG00000033016
AA Change: M514T

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 156 188 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
Pfam:RHD 415 575 4.9e-28 PFAM
IPT 582 681 8.99e-21 SMART
low complexity region 832 841 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170905
AA Change: M528T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129001
Gene: ENSMUSG00000033016
AA Change: M528T

DomainStartEndE-ValueType
low complexity region 170 202 N/A INTRINSIC
low complexity region 277 293 N/A INTRINSIC
Pfam:RHD_DNA_bind 429 589 5.1e-28 PFAM
IPT 596 695 8.99e-21 SMART
low complexity region 846 855 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the nuclear factor of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation, and an inducible nuclear component. Proteins belonging to this family of transcription factors play a central role in inducible gene transcription during immune response. The product of this gene is an inducible nuclear component. It functions as a major molecular target for the immunosuppressive drugs such as cyclosporin A. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Different isoforms of this protein may regulate inducible expression of different cytokine genes. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality throughout fetal growth and development due to cardiac failure. Mutants exhibit blood circulation, cardiac valve and ventricular septal abnormalities, edema, abdominal hemorrhage, and semilunar valveregurgitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A G 12: 55,565,911 E207G probably benign Het
Arhgap19 T A 19: 41,801,973 S19C probably benign Het
Arhgef18 T A 8: 3,441,272 D374E possibly damaging Het
Atf2 A G 2: 73,853,789 probably null Het
C130026I21Rik A G 1: 85,254,186 probably benign Het
Cadm1 A G 9: 47,813,841 N300S probably benign Het
Ccdc159 A T 9: 21,929,370 I78F possibly damaging Het
Cdh4 T C 2: 179,889,092 I589T possibly damaging Het
Clstn1 T C 4: 149,629,407 I182T probably damaging Het
Cnga3 T A 1: 37,244,828 probably benign Het
Cntln T A 4: 85,063,181 S865R probably damaging Het
Col5a3 C T 9: 20,772,220 G1552E unknown Het
Col6a4 A C 9: 105,997,135 S2218A probably benign Het
Ephb1 T C 9: 102,001,711 T527A probably benign Het
Fkbp15 T A 4: 62,323,202 I569F possibly damaging Het
Gabra4 A G 5: 71,571,986 S484P possibly damaging Het
Glce T C 9: 62,070,561 I14V possibly damaging Het
Gm4884 A T 7: 41,042,841 Q78L probably damaging Het
Gpn1 A G 5: 31,503,404 T180A possibly damaging Het
Gpr6 A T 10: 41,071,292 I98N probably damaging Het
Hcrtr2 T C 9: 76,323,440 N22S probably benign Het
Hfm1 C T 5: 106,893,523 V665I possibly damaging Het
Il4ra T A 7: 125,570,053 I159N possibly damaging Het
Irf8 G C 8: 120,739,822 C2S possibly damaging Het
Itih2 A T 2: 10,102,079 N701K probably benign Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mmp10 T A 9: 7,504,995 Y263* probably null Het
Morc3 T A 16: 93,874,806 M835K probably benign Het
Msh3 A G 13: 92,344,954 probably null Het
Ncbp1 A G 4: 46,171,963 H777R possibly damaging Het
Nlrp3 T A 11: 59,548,476 I293N probably damaging Het
Pank2 A T 2: 131,273,969 E102D probably damaging Het
Pbrm1 A G 14: 31,032,548 D175G probably benign Het
Pcdh9 T C 14: 93,885,875 D953G probably benign Het
Pibf1 G A 14: 99,186,481 V497I probably benign Het
Pkd1 G A 17: 24,581,640 M3085I probably benign Het
Prss58 A T 6: 40,897,314 C143S possibly damaging Het
Rassf8 A G 6: 145,820,103 probably benign Het
Spag7 T A 11: 70,664,862 D73V probably damaging Het
Sult3a1 A T 10: 33,870,250 M189L probably benign Het
Syt4 T C 18: 31,444,016 D95G probably damaging Het
Tbc1d8 A C 1: 39,380,236 S766A probably benign Het
Tmco5 A T 2: 116,880,315 M39L probably benign Het
Trcg1 A G 9: 57,248,672 N797S possibly damaging Het
Trim34a A T 7: 104,261,338 probably null Het
Ubr5 T C 15: 38,009,113 probably benign Het
Urb2 A G 8: 124,029,624 N690S probably benign Het
Zfp445 A G 9: 122,852,549 Y776H possibly damaging Het
Zfp52 G A 17: 21,561,571 M560I probably benign Het
Zfp608 A G 18: 54,988,294 S74P probably benign Het
Zfp629 A G 7: 127,611,840 C266R probably damaging Het
Zscan2 A G 7: 80,875,386 K285R probably benign Het
Other mutations in Nfatc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Nfatc1 APN 18 80667026 missense probably damaging 1.00
IGL00742:Nfatc1 APN 18 80698014 missense probably benign 0.20
IGL01510:Nfatc1 APN 18 80698188 missense probably damaging 1.00
IGL01790:Nfatc1 APN 18 80667042 missense probably damaging 1.00
IGL02548:Nfatc1 APN 18 80697898 missense probably damaging 1.00
goldfeld UTSW 18 80697832 missense probably damaging 0.99
R0019:Nfatc1 UTSW 18 80635504 missense probably benign
R0411:Nfatc1 UTSW 18 80698042 missense possibly damaging 0.88
R0738:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R0940:Nfatc1 UTSW 18 80635895 missense probably benign 0.03
R1458:Nfatc1 UTSW 18 80665267 splice site probably benign
R1845:Nfatc1 UTSW 18 80635531 missense possibly damaging 0.67
R2110:Nfatc1 UTSW 18 80635664 nonsense probably null
R2112:Nfatc1 UTSW 18 80635664 nonsense probably null
R2157:Nfatc1 UTSW 18 80635845 missense possibly damaging 0.88
R3857:Nfatc1 UTSW 18 80665275 splice site probably benign
R3859:Nfatc1 UTSW 18 80665275 splice site probably benign
R4108:Nfatc1 UTSW 18 80698368 missense possibly damaging 0.68
R4510:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4511:Nfatc1 UTSW 18 80635579 missense probably damaging 0.96
R4618:Nfatc1 UTSW 18 80697832 missense probably damaging 0.99
R4850:Nfatc1 UTSW 18 80697865 missense probably benign 0.30
R5329:Nfatc1 UTSW 18 80708117 start codon destroyed probably null
R5395:Nfatc1 UTSW 18 80636020 missense possibly damaging 0.80
R5468:Nfatc1 UTSW 18 80649855 missense probably benign 0.00
R5522:Nfatc1 UTSW 18 80653529 missense probably benign 0.36
R5568:Nfatc1 UTSW 18 80649822 missense probably benign 0.12
R6111:Nfatc1 UTSW 18 80697910 missense probably damaging 1.00
R6190:Nfatc1 UTSW 18 80712670 missense probably benign 0.21
R6397:Nfatc1 UTSW 18 80635941 missense probably damaging 1.00
R6943:Nfatc1 UTSW 18 80635555 missense probably damaging 1.00
R6970:Nfatc1 UTSW 18 80667013 missense probably benign 0.34
X0062:Nfatc1 UTSW 18 80697618 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGCTGTGTGACTGAGACACCTTTG -3'
(R):5'- GTGCCTACTTACTGCGAGTCTTCTG -3'

Sequencing Primer
(F):5'- GTGCCATAACACACAGCACC -3'
(R):5'- CGGTTACTTGGAGAATGAACCTC -3'
Posted On2014-04-24