Incidental Mutation 'R1623:Notch1'
ID174751
Institutional Source Beutler Lab
Gene Symbol Notch1
Ensembl Gene ENSMUSG00000026923
Gene Namenotch 1
SynonymsTan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26457903-26516663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26478612 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 555 (T555I)
Ref Sequence ENSEMBL: ENSMUSP00000028288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]
PDB Structure
The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028288
AA Change: T555I

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: T555I

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 23 58 1.63e1 SMART
EGF 62 99 4.29e-5 SMART
EGF 105 139 6.25e-7 SMART
EGF_CA 140 176 1.02e-6 SMART
EGF_CA 178 216 4.21e-13 SMART
EGF 221 255 6.7e-7 SMART
EGF_CA 257 293 6.8e-8 SMART
EGF_CA 295 333 1.16e-10 SMART
EGF_CA 335 371 3.17e-8 SMART
EGF 375 410 5.32e-1 SMART
EGF_CA 412 450 4.59e-14 SMART
EGF_CA 452 488 1.02e-11 SMART
EGF_CA 490 526 4.81e-8 SMART
EGF_CA 528 564 3.19e-13 SMART
EGF_CA 566 601 1.91e-11 SMART
EGF_CA 603 639 1.78e-11 SMART
EGF_CA 641 676 9.62e-8 SMART
EGF_CA 678 714 2.38e-12 SMART
EGF_CA 716 751 5.23e-9 SMART
EGF_CA 753 789 6.25e-7 SMART
EGF_CA 791 827 1.1e-11 SMART
EGF 832 867 2.03e-6 SMART
EGF_CA 869 905 5.73e-15 SMART
EGF_CA 907 943 4.56e-9 SMART
EGF_CA 945 981 1.64e-10 SMART
EGF_CA 983 1019 5.83e-7 SMART
EGF_CA 1021 1057 1.05e-13 SMART
EGF 1062 1095 8.12e-6 SMART
EGF 1100 1143 5.66e-5 SMART
EGF_CA 1145 1181 1.1e-11 SMART
EGF_CA 1183 1219 3.87e-12 SMART
EGF_CA 1221 1265 2.89e-11 SMART
EGF_CA 1267 1305 1.2e-8 SMART
EGF 1310 1346 5.74e-6 SMART
EGF 1351 1384 4.1e-2 SMART
EGF 1390 1426 2.66e-1 SMART
NL 1442 1480 4.08e-16 SMART
NL 1483 1522 1.08e-15 SMART
NL 1523 1562 7.39e-14 SMART
NOD 1566 1622 1.81e-32 SMART
NODP 1660 1722 3.27e-30 SMART
low complexity region 1729 1746 N/A INTRINSIC
ANK 1870 1912 1.07e2 SMART
ANK 1917 1946 4.82e-3 SMART
ANK 1950 1980 6.71e-2 SMART
ANK 1984 2013 1.23e0 SMART
ANK 2017 2046 9.13e-4 SMART
ANK 2050 2079 2.97e-3 SMART
low complexity region 2205 2222 N/A INTRINSIC
low complexity region 2364 2395 N/A INTRINSIC
DUF3454 2453 2517 2.01e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132820
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Notch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Notch1 APN 2 26460046 missense probably damaging 0.98
IGL01343:Notch1 APN 2 26472905 missense probably benign 0.25
IGL02066:Notch1 APN 2 26460396 missense possibly damaging 0.71
IGL02158:Notch1 APN 2 26460339 missense probably damaging 1.00
IGL02541:Notch1 APN 2 26468503 missense probably benign 0.12
IGL03280:Notch1 APN 2 26477874 intron probably benign
IGL03338:Notch1 APN 2 26459959 missense probably benign
Antero UTSW 2 26476114 missense possibly damaging 0.96
march UTSW 2 26469899 missense probably damaging 0.98
PIT4494001:Notch1 UTSW 2 26466473 missense probably damaging 1.00
R0013:Notch1 UTSW 2 26473818 missense possibly damaging 0.64
R0025:Notch1 UTSW 2 26470931 missense probably damaging 1.00
R0129:Notch1 UTSW 2 26460458 missense probably benign 0.06
R0285:Notch1 UTSW 2 26460861 missense possibly damaging 0.88
R0531:Notch1 UTSW 2 26466572 missense probably benign 0.00
R0747:Notch1 UTSW 2 26472140 missense unknown
R1440:Notch1 UTSW 2 26480964 intron probably benign
R1502:Notch1 UTSW 2 26484323 missense possibly damaging 0.95
R1539:Notch1 UTSW 2 26472113 nonsense probably null
R1844:Notch1 UTSW 2 26460434 missense probably benign 0.12
R1863:Notch1 UTSW 2 26469950 missense probably damaging 1.00
R1874:Notch1 UTSW 2 26481579 missense possibly damaging 0.89
R1926:Notch1 UTSW 2 26481657 missense probably damaging 1.00
R2156:Notch1 UTSW 2 26460861 missense possibly damaging 0.91
R2196:Notch1 UTSW 2 26463804 nonsense probably null
R2209:Notch1 UTSW 2 26460007 missense probably benign
R2382:Notch1 UTSW 2 26473781 missense probably benign 0.40
R2508:Notch1 UTSW 2 26465473 missense possibly damaging 0.80
R2873:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R2874:Notch1 UTSW 2 26460235 missense possibly damaging 0.89
R3798:Notch1 UTSW 2 26478618 missense probably benign 0.00
R4019:Notch1 UTSW 2 26481142 missense probably benign 0.03
R4305:Notch1 UTSW 2 26477924 missense probably damaging 1.00
R4334:Notch1 UTSW 2 26460036 missense probably benign 0.22
R4504:Notch1 UTSW 2 26472177 missense probably benign 0.16
R4624:Notch1 UTSW 2 26478081 missense possibly damaging 0.94
R4659:Notch1 UTSW 2 26470889 missense probably damaging 0.99
R4703:Notch1 UTSW 2 26471158 missense probably benign
R4869:Notch1 UTSW 2 26471179 missense probably benign 0.21
R4938:Notch1 UTSW 2 26474124 nonsense probably null
R4989:Notch1 UTSW 2 26481181 missense probably damaging 1.00
R5010:Notch1 UTSW 2 26476114 missense possibly damaging 0.96
R5283:Notch1 UTSW 2 26468626 missense probably damaging 1.00
R5303:Notch1 UTSW 2 26478619 missense probably benign 0.01
R5635:Notch1 UTSW 2 26476161 missense probably damaging 1.00
R5755:Notch1 UTSW 2 26473692 missense probably benign 0.12
R5926:Notch1 UTSW 2 26476104 missense probably benign 0.35
R5947:Notch1 UTSW 2 26462528 intron probably benign
R6053:Notch1 UTSW 2 26472912 missense probably benign 0.06
R6161:Notch1 UTSW 2 26468731 missense probably damaging 1.00
R6162:Notch1 UTSW 2 26462195 missense probably benign
R6174:Notch1 UTSW 2 26485442 missense possibly damaging 0.50
R6199:Notch1 UTSW 2 26469899 missense probably damaging 0.98
R6209:Notch1 UTSW 2 26472805 missense probably damaging 1.00
R6251:Notch1 UTSW 2 26474170 missense possibly damaging 0.64
R6493:Notch1 UTSW 2 26472098 missense unknown
R6723:Notch1 UTSW 2 26478106 missense probably damaging 1.00
R6736:Notch1 UTSW 2 26460286 missense probably benign 0.01
R7020:Notch1 UTSW 2 26481574 missense possibly damaging 0.95
R7058:Notch1 UTSW 2 26463818 missense probably benign 0.05
R7154:Notch1 UTSW 2 26459938 missense probably benign
R7291:Notch1 UTSW 2 26476375 missense probably benign 0.01
R7379:Notch1 UTSW 2 26479467 missense probably damaging 1.00
R7560:Notch1 UTSW 2 26460165 missense not run
X0018:Notch1 UTSW 2 26462227 nonsense probably null
X0066:Notch1 UTSW 2 26470335 missense possibly damaging 0.90
Z1088:Notch1 UTSW 2 26477115 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTCACACTCGTCAATGTCCACTTC -3'
(R):5'- TGGCCCCTGTTATCAAAGTACCCTC -3'

Sequencing Primer
(F):5'- GTCCCTGTGTAACCTAGATGGC -3'
(R):5'- GCCCATGTGAGCAGACATTC -3'
Posted On2014-04-24