Incidental Mutation 'R1623:Trpc4'
ID174762
Institutional Source Beutler Lab
Gene Symbol Trpc4
Ensembl Gene ENSMUSG00000027748
Gene Nametransient receptor potential cation channel, subfamily C, member 4
SynonymsTrrp4, STRPC4, Trp4, CCE1
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54156035-54318471 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54299179 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 600 (M600K)
Ref Sequence ENSEMBL: ENSMUSP00000143593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029311] [ENSMUST00000200048] [ENSMUST00000200341]
Predicted Effect probably damaging
Transcript: ENSMUST00000029311
AA Change: M600K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029311
Gene: ENSMUSG00000027748
AA Change: M600K

DomainStartEndE-ValueType
Blast:ANK 33 63 4e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.2e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 4.2e-33 PFAM
low complexity region 763 780 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200048
AA Change: M600K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143593
Gene: ENSMUSG00000027748
AA Change: M600K

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 1.1e-30 PFAM
transmembrane domain 328 350 N/A INTRINSIC
Pfam:Ion_trans 363 632 3.5e-33 PFAM
low complexity region 763 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200341
SMART Domains Protein: ENSMUSP00000142921
Gene: ENSMUSG00000027748

DomainStartEndE-ValueType
Blast:ANK 33 63 2e-7 BLAST
ANK 69 98 8.72e-1 SMART
ANK 141 170 5.09e-2 SMART
Pfam:TRP_2 176 238 6.4e-33 PFAM
transmembrane domain 331 351 N/A INTRINSIC
transmembrane domain 366 383 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the canonical subfamily of transient receptor potential cation channels. The encoded protein forms a non-selective calcium-permeable cation channel that is activated by Gq-coupled receptors and tyrosine kinases, and plays a role in multiple processes including endothelial permeability, vasodilation, neurotransmitter release and cell proliferation. Single nucleotide polymorphisms in this gene may be associated with generalized epilepsy with photosensitivity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit a significant reduction in agonist-induced Ca2+ entry and vasorelaxation of aortic rings. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Trpc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trpc4 APN 3 54302175 missense probably damaging 1.00
IGL01067:Trpc4 APN 3 54222562 missense probably benign 0.01
IGL01475:Trpc4 APN 3 54266407 missense possibly damaging 0.87
IGL01544:Trpc4 APN 3 54302146 missense probably damaging 0.99
IGL01688:Trpc4 APN 3 54266074 splice site probably benign
IGL02134:Trpc4 APN 3 54315654 missense possibly damaging 0.46
IGL02237:Trpc4 APN 3 54222362 missense probably damaging 1.00
IGL02301:Trpc4 APN 3 54291232 missense probably damaging 1.00
IGL02549:Trpc4 APN 3 54222349 missense possibly damaging 0.92
IGL02742:Trpc4 APN 3 54299246 missense probably damaging 1.00
IGL02815:Trpc4 APN 3 54299274 splice site probably benign
R0498:Trpc4 UTSW 3 54291211 missense probably damaging 1.00
R0555:Trpc4 UTSW 3 54302090 splice site probably benign
R0609:Trpc4 UTSW 3 54194768 missense probably damaging 1.00
R1351:Trpc4 UTSW 3 54195002 missense probably damaging 1.00
R1595:Trpc4 UTSW 3 54315815 missense probably benign 0.02
R1763:Trpc4 UTSW 3 54194822 missense possibly damaging 0.90
R1843:Trpc4 UTSW 3 54279994 missense probably benign 0.19
R1856:Trpc4 UTSW 3 54279989 missense probably damaging 1.00
R1936:Trpc4 UTSW 3 54279890 missense probably damaging 1.00
R2196:Trpc4 UTSW 3 54302193 missense probably benign 0.03
R2441:Trpc4 UTSW 3 54222283 missense probably damaging 0.96
R2877:Trpc4 UTSW 3 54291340 missense probably damaging 1.00
R3846:Trpc4 UTSW 3 54318012 missense probably benign 0.22
R3931:Trpc4 UTSW 3 54318095 missense probably damaging 1.00
R4854:Trpc4 UTSW 3 54302218 missense probably damaging 1.00
R5024:Trpc4 UTSW 3 54194796 missense probably benign 0.11
R5284:Trpc4 UTSW 3 54279947 missense probably damaging 0.99
R5320:Trpc4 UTSW 3 54299178 missense probably damaging 0.99
R5973:Trpc4 UTSW 3 54315842 missense probably damaging 1.00
R6276:Trpc4 UTSW 3 54318020 missense probably benign 0.25
R6335:Trpc4 UTSW 3 54317574 critical splice donor site probably null
X0066:Trpc4 UTSW 3 54194750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACAAAAGGTAGGTTCCAATGCCC -3'
(R):5'- TGGACTGCTGATAGATGGCTGATCTC -3'

Sequencing Primer
(F):5'- AGGTTCCAATGCCCTTTGGATAG -3'
(R):5'- ATGGCTCCCTGGCAACATAG -3'
Posted On2014-04-24