Incidental Mutation 'R1623:Trdn'
ID174799
Institutional Source Beutler Lab
Gene Symbol Trdn
Ensembl Gene ENSMUSG00000019787
Gene Nametriadin
Synonymstriadin-2, triadin 2, triadin 1, triadin 3, EG432451, 2310045H21Rik, triadin-1, triadin-3
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location33080554-33476709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33258102 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 333 (K333R)
Ref Sequence ENSEMBL: ENSMUSP00000093436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095762
AA Change: K333R

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000093436
Gene: ENSMUSG00000019787
AA Change: K333R

DomainStartEndE-ValueType
SCOP:d1lnqa2 49 116 1e-4 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 166 182 N/A INTRINSIC
low complexity region 198 223 N/A INTRINSIC
low complexity region 229 250 N/A INTRINSIC
coiled coil region 306 333 N/A INTRINSIC
low complexity region 342 352 N/A INTRINSIC
low complexity region 380 396 N/A INTRINSIC
coiled coil region 417 437 N/A INTRINSIC
low complexity region 448 484 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 559 572 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217716
Predicted Effect unknown
Transcript: ENSMUST00000219211
AA Change: K137R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219691
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit a loss of transverse orientation of triads within skeletal muscle cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Trdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Trdn APN 10 33471606 critical splice donor site probably null
IGL01310:Trdn APN 10 33305098 splice site probably benign
IGL01313:Trdn APN 10 33200220 missense probably damaging 1.00
IGL02177:Trdn APN 10 33139173 missense probably damaging 1.00
IGL02631:Trdn APN 10 33363976 critical splice acceptor site probably null
IGL02732:Trdn APN 10 33468199 splice site probably null
IGL03131:Trdn APN 10 33398414 nonsense probably null
Button UTSW 10 33474453 missense probably damaging 0.97
R0463:Trdn UTSW 10 33466421 critical splice acceptor site probably null
R0610:Trdn UTSW 10 33474453 missense probably damaging 0.97
R0786:Trdn UTSW 10 33305081 missense probably benign 0.22
R0827:Trdn UTSW 10 33399158 splice site probably benign
R1511:Trdn UTSW 10 33466452 missense probably benign 0.18
R1760:Trdn UTSW 10 33233887 missense possibly damaging 0.92
R1766:Trdn UTSW 10 33364008 missense probably damaging 1.00
R1884:Trdn UTSW 10 33257095 missense probably benign 0.38
R2297:Trdn UTSW 10 33335012 missense probably damaging 1.00
R2396:Trdn UTSW 10 33195982 missense probably damaging 1.00
R3436:Trdn UTSW 10 33468195 critical splice donor site probably null
R3686:Trdn UTSW 10 33468189 missense probably benign 0.20
R3696:Trdn UTSW 10 33305032 splice site probably null
R3701:Trdn UTSW 10 33334984 missense probably damaging 0.99
R3712:Trdn UTSW 10 33157166 missense probably benign 0.03
R4062:Trdn UTSW 10 33257087 missense probably benign 0.05
R4249:Trdn UTSW 10 33450998 missense probably benign 0.09
R4289:Trdn UTSW 10 33464582 missense probably benign 0.00
R4646:Trdn UTSW 10 33195981 nonsense probably null
R4647:Trdn UTSW 10 33195981 nonsense probably null
R4648:Trdn UTSW 10 33195981 nonsense probably null
R4766:Trdn UTSW 10 33474506 missense probably benign 0.04
R4776:Trdn UTSW 10 33399082 splice site probably null
R4880:Trdn UTSW 10 33471579 missense probably benign 0.26
R4898:Trdn UTSW 10 33474417 missense probably damaging 0.96
R5017:Trdn UTSW 10 33468159 missense probably benign 0.05
R5300:Trdn UTSW 10 33195982 missense probably damaging 1.00
R5320:Trdn UTSW 10 33333251 critical splice donor site probably null
R6089:Trdn UTSW 10 33464575 missense probably benign 0.01
R6216:Trdn UTSW 10 33305069 missense probably damaging 1.00
R6431:Trdn UTSW 10 33139114 missense probably damaging 1.00
R6475:Trdn UTSW 10 33464555 splice site probably null
R6501:Trdn UTSW 10 33466454 missense probably benign 0.02
R6662:Trdn UTSW 10 33474487 missense probably damaging 0.98
R6709:Trdn UTSW 10 33464591 missense probably benign 0.00
R6783:Trdn UTSW 10 33438815 missense probably damaging 0.96
R6906:Trdn UTSW 10 33233948 missense probably benign
R6916:Trdn UTSW 10 33157018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGACAAGTCATCTGGCATCTTA -3'
(R):5'- CCACACTTCTGTTTTGACATGCTACAC -3'

Sequencing Primer
(F):5'- ACAGGAATCCTAAGCTTTCGGTG -3'
(R):5'- GCTACACATGGATAGATGTGAATACC -3'
Posted On2014-04-24