Incidental Mutation 'R1623:Dnah9'
ID174807
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66037637 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 2069 (M2069V)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: M2069V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: M2069V

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 unclassified probably null
R0974:Dnah9 UTSW 11 66005837 unclassified probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCACAAAGTTGTCCTCAGCC -3'
(R):5'- TCCACCTGAGCTTCAGTAGTGACC -3'

Sequencing Primer
(F):5'- AAAGTTGTCCTCAGCCTGGAG -3'
(R):5'- GACCATGCTATAATTCTGTGTGAG -3'
Posted On2014-04-24