Incidental Mutation 'R1623:Chrne'
ID174810
Institutional Source Beutler Lab
Gene Symbol Chrne
Ensembl Gene ENSMUSG00000014609
Gene Namecholinergic receptor, nicotinic, epsilon polypeptide
SynonymsAChrepsilon, Acre
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70614883-70619216 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70618428 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 109 (E109G)
Ref Sequence ENSEMBL: ENSMUSP00000099616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014753] [ENSMUST00000072237] [ENSMUST00000072873] [ENSMUST00000079244] [ENSMUST00000102556] [ENSMUST00000102558] [ENSMUST00000102559] [ENSMUST00000135865] [ENSMUST00000144960] [ENSMUST00000180052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014753
AA Change: E109G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000014753
Gene: ENSMUSG00000014609
AA Change: E109G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 2.9e-65 PFAM
Pfam:Neur_chan_memb 247 475 6.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072237
SMART Domains Protein: ENSMUSP00000072091
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 837 874 N/A INTRINSIC
CNH 1026 1324 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072873
SMART Domains Protein: ENSMUSP00000072649
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 719 738 N/A INTRINSIC
low complexity region 829 853 N/A INTRINSIC
CNH 1019 1317 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079244
SMART Domains Protein: ENSMUSP00000078234
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 314 338 N/A INTRINSIC
coiled coil region 348 493 N/A INTRINSIC
low complexity region 554 566 N/A INTRINSIC
low complexity region 617 630 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 716 735 N/A INTRINSIC
low complexity region 826 850 N/A INTRINSIC
CNH 1016 1314 1.58e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102556
AA Change: E109G

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099616
Gene: ENSMUSG00000014609
AA Change: E109G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 24 240 5.4e-65 PFAM
Pfam:Neur_chan_memb 247 474 2.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102558
SMART Domains Protein: ENSMUSP00000099618
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 792 816 N/A INTRINSIC
CNH 982 1280 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102559
SMART Domains Protein: ENSMUSP00000099619
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
S_TKc 25 289 1.86e-91 SMART
low complexity region 307 338 N/A INTRINSIC
coiled coil region 351 496 N/A INTRINSIC
low complexity region 557 569 N/A INTRINSIC
low complexity region 620 633 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
low complexity region 800 824 N/A INTRINSIC
CNH 990 1288 1.58e-113 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134836
Predicted Effect probably benign
Transcript: ENSMUST00000135865
SMART Domains Protein: ENSMUSP00000135933
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 101 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135920
Predicted Effect probably benign
Transcript: ENSMUST00000136663
SMART Domains Protein: ENSMUSP00000117959
Gene: ENSMUSG00000020827

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 140 2.3e-22 PFAM
Pfam:Pkinase 1 143 1.6e-30 PFAM
low complexity region 161 192 N/A INTRINSIC
coiled coil region 204 349 N/A INTRINSIC
low complexity region 411 423 N/A INTRINSIC
low complexity region 474 487 N/A INTRINSIC
low complexity region 500 513 N/A INTRINSIC
low complexity region 573 592 N/A INTRINSIC
low complexity region 691 728 N/A INTRINSIC
CNH 880 1178 1.58e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144960
SMART Domains Protein: ENSMUSP00000136077
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151599
Predicted Effect probably benign
Transcript: ENSMUST00000180052
SMART Domains Protein: ENSMUSP00000137259
Gene: ENSMUSG00000087279

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the epsilon subunit of the muscle-derived nicotinic acetylcholine receptor, a pentameric neurotransmitter receptor and member of the ligand-gated ion channel superfamily. The acetylcholine receptor changes subunit composition shortly after birth when the epsilon subunit replaces the gamma subunit seen in embryonic receptors. In mice, deficiency of this gene can lead to a decline in the number of nicotinic acetylcholine receptors at neuromuscular junctions and causes progressive muscle weakness, atrophy and premature death. Mutations in this gene serve as a pathophysiological model for human congenital myasthenia. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced AChR receptor density at neuromuscular synapses, impaired neuromuscular transmission, progressive muscular weakness and atrophy, and lethality at 2-3 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Chrne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Chrne APN 11 70615762 missense probably benign 0.00
IGL00950:Chrne APN 11 70619157 unclassified probably benign
IGL01875:Chrne APN 11 70618672 splice site probably null
IGL03201:Chrne APN 11 70618512 missense probably benign 0.02
IGL03303:Chrne APN 11 70615100 missense possibly damaging 0.77
pip-squeak UTSW 11 70615130 critical splice acceptor site probably null
R0419:Chrne UTSW 11 70615723 missense probably benign
R0848:Chrne UTSW 11 70615413 missense probably benign 0.02
R1378:Chrne UTSW 11 70615130 critical splice acceptor site probably null
R2170:Chrne UTSW 11 70618497 missense probably damaging 1.00
R2437:Chrne UTSW 11 70615260 missense possibly damaging 0.92
R3945:Chrne UTSW 11 70617043 missense possibly damaging 0.95
R4612:Chrne UTSW 11 70617022 missense probably damaging 0.99
R4923:Chrne UTSW 11 70615275 missense possibly damaging 0.62
R5172:Chrne UTSW 11 70615526 missense probably benign 0.00
R5288:Chrne UTSW 11 70615087 missense possibly damaging 0.63
R5384:Chrne UTSW 11 70615087 missense possibly damaging 0.63
R5614:Chrne UTSW 11 70615053 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ACATTGCTGTCGTAGGCCACTC -3'
(R):5'- TAACTCCTGGCTTCAGCAGGCTTC -3'

Sequencing Primer
(F):5'- TGTCGTAGGCCACTCCAAAC -3'
(R):5'- ACCACCAGTGTCTGGATTG -3'
Posted On2014-04-24