Incidental Mutation 'R1623:Tonsl'
ID174824
Institutional Source Beutler Lab
Gene Symbol Tonsl
Ensembl Gene ENSMUSG00000059323
Gene Nametonsoku-like, DNA repair protein
SynonymsNfkbil2, 2810439M11Rik
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R1623 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76626002-76639958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76638509 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 181 (C181R)
Ref Sequence ENSEMBL: ENSMUSP00000129597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081291] [ENSMUST00000165190] [ENSMUST00000166974] [ENSMUST00000168185]
Predicted Effect probably benign
Transcript: ENSMUST00000081291
SMART Domains Protein: ENSMUSP00000080043
Gene: ENSMUSG00000053929

DomainStartEndE-ValueType
SCOP:d1jm7a_ 21 88 3e-5 SMART
Blast:RING 27 62 8e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163161
Predicted Effect probably damaging
Transcript: ENSMUST00000165190
AA Change: C181R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323
AA Change: C181R

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 4e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
low complexity region 259 271 N/A INTRINSIC
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166974
Predicted Effect probably damaging
Transcript: ENSMUST00000168185
AA Change: C181R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323
AA Change: C181R

DomainStartEndE-ValueType
TPR 27 60 5.33e1 SMART
Blast:TPR 67 100 7e-9 BLAST
TPR 162 195 1.77e1 SMART
TPR 202 235 1.36e1 SMART
Pfam:TPR_8 242 274 8.7e-3 PFAM
TPR 311 344 1.4e1 SMART
TPR 352 385 7.27e0 SMART
low complexity region 413 437 N/A INTRINSIC
low complexity region 465 494 N/A INTRINSIC
low complexity region 500 511 N/A INTRINSIC
ANK 528 559 8.36e1 SMART
ANK 561 590 4.85e-8 SMART
ANK 597 626 2.85e-5 SMART
low complexity region 690 707 N/A INTRINSIC
low complexity region 729 753 N/A INTRINSIC
low complexity region 1031 1044 N/A INTRINSIC
LRR 1058 1085 2.86e-1 SMART
LRR 1086 1113 5.88e-1 SMART
LRR 1117 1144 1.67e-2 SMART
LRR 1177 1204 2.72e0 SMART
LRR 1236 1263 7.02e0 SMART
LRR 1264 1292 1.46e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171478
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Fbn2 G T 18: 58,048,548 N1880K possibly damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Tonsl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tonsl APN 15 76638496 missense possibly damaging 0.78
IGL00763:Tonsl APN 15 76633868 missense probably damaging 1.00
IGL00796:Tonsl APN 15 76625149 missense probably benign
IGL00965:Tonsl APN 15 76631880 splice site probably benign
IGL01434:Tonsl APN 15 76631102 missense probably benign 0.11
IGL01859:Tonsl APN 15 76634780 missense probably damaging 0.97
IGL02112:Tonsl APN 15 76633402 missense probably benign 0.01
IGL02189:Tonsl APN 15 76623178 missense possibly damaging 0.56
IGL02281:Tonsl APN 15 76634074 missense probably damaging 1.00
IGL02627:Tonsl APN 15 76634095 missense probably damaging 0.99
IGL02750:Tonsl APN 15 76633389 missense probably damaging 0.97
IGL02977:Tonsl APN 15 76632873 missense probably benign 0.00
R0127:Tonsl UTSW 15 76633485 missense probably benign 0.01
R0316:Tonsl UTSW 15 76629300 missense possibly damaging 0.68
R0443:Tonsl UTSW 15 76639684 missense probably benign
R0714:Tonsl UTSW 15 76633721 splice site probably benign
R0946:Tonsl UTSW 15 76623221 missense probably benign 0.03
R0975:Tonsl UTSW 15 76638932 missense probably damaging 0.99
R1263:Tonsl UTSW 15 76622562 missense possibly damaging 0.85
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1468:Tonsl UTSW 15 76636561 critical splice donor site probably null
R1610:Tonsl UTSW 15 76638557 missense probably damaging 1.00
R1763:Tonsl UTSW 15 76638066 missense probably damaging 1.00
R1882:Tonsl UTSW 15 76624150 missense possibly damaging 0.83
R1898:Tonsl UTSW 15 76638853 unclassified probably null
R1932:Tonsl UTSW 15 76624597 missense probably damaging 0.97
R2141:Tonsl UTSW 15 76632661 missense probably damaging 0.99
R2166:Tonsl UTSW 15 76637313 missense probably benign 0.13
R2191:Tonsl UTSW 15 76632680 missense probably damaging 0.96
R2198:Tonsl UTSW 15 76636672 missense probably benign 0.00
R2219:Tonsl UTSW 15 76634640 missense probably damaging 1.00
R2762:Tonsl UTSW 15 76630620 missense probably damaging 1.00
R3156:Tonsl UTSW 15 76639521 missense probably damaging 1.00
R3508:Tonsl UTSW 15 76639756 missense probably benign
R4012:Tonsl UTSW 15 76637044 missense probably damaging 1.00
R4179:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4180:Tonsl UTSW 15 76624475 missense probably damaging 1.00
R4327:Tonsl UTSW 15 76639716 missense probably benign
R4627:Tonsl UTSW 15 76637224 missense probably damaging 1.00
R4671:Tonsl UTSW 15 76623410 missense probably benign 0.01
R4825:Tonsl UTSW 15 76633248 missense probably benign 0.34
R4840:Tonsl UTSW 15 76633209 missense probably benign
R5030:Tonsl UTSW 15 76638101 missense probably damaging 1.00
R5143:Tonsl UTSW 15 76636657 missense possibly damaging 0.80
R6238:Tonsl UTSW 15 76636218 unclassified probably null
R6379:Tonsl UTSW 15 76629742 missense probably benign
R6401:Tonsl UTSW 15 76633666 missense probably damaging 1.00
R6534:Tonsl UTSW 15 76629677 missense probably damaging 1.00
R6695:Tonsl UTSW 15 76629818 missense possibly damaging 0.84
R6701:Tonsl UTSW 15 76629300 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACCTTGGAACAGTGAGACACCG -3'
(R):5'- GAGTGCCTGAAAACCCCATATCCTG -3'

Sequencing Primer
(F):5'- GATGTTCAACCAGTTACGGC -3'
(R):5'- TTTTTCCAGGGATGCTGACC -3'
Posted On2014-04-24