Incidental Mutation 'R1623:Fbn2'
ID174839
Institutional Source Beutler Lab
Gene Symbol Fbn2
Ensembl Gene ENSMUSG00000024598
Gene Namefibrillin 2
SynonymsFib-2, sy, Sne
MMRRC Submission 039660-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.519) question?
Stock #R1623 (G1)
Quality Score153
Status Not validated
Chromosome18
Chromosomal Location58008623-58209926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58048548 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1880 (N1880K)
Ref Sequence ENSEMBL: ENSMUSP00000025497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025497
AA Change: N1880K

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025497
Gene: ENSMUSG00000024598
AA Change: N1880K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
low complexity region 68 77 N/A INTRINSIC
EGF 148 176 1.15e1 SMART
EGF 179 208 1.26e-2 SMART
Pfam:TB 224 262 3.7e-10 PFAM
EGF_CA 276 317 8.3e-12 SMART
EGF_CA 318 359 9.25e-10 SMART
Pfam:TB 374 416 4.3e-13 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
EGF 490 527 1.13e-4 SMART
EGF_CA 528 567 2.26e-13 SMART
EGF_CA 568 609 9.03e-13 SMART
EGF_CA 610 650 6.2e-11 SMART
EGF_CA 651 691 7.75e-12 SMART
Pfam:TB 707 748 5.2e-15 PFAM
EGF_CA 761 802 6.29e-12 SMART
EGF_CA 803 844 1.97e-13 SMART
EGF_CA 845 884 1.61e-9 SMART
Pfam:TB 899 935 1.8e-9 PFAM
EGF_CA 948 989 4.7e-11 SMART
Pfam:TB 1004 1044 1.3e-16 PFAM
EGF_CA 1066 1107 3.05e-10 SMART
EGF_CA 1108 1150 2.19e-11 SMART
EGF_CA 1151 1192 2.04e-11 SMART
EGF_CA 1193 1234 3.15e-12 SMART
EGF_CA 1235 1275 1.82e-8 SMART
EGF_CA 1276 1317 9.91e-10 SMART
EGF_CA 1318 1359 1.48e-8 SMART
EGF_CA 1360 1400 6.54e-10 SMART
EGF_CA 1401 1441 4.63e-10 SMART
EGF_CA 1442 1483 7.75e-12 SMART
EGF_CA 1484 1524 5.23e-9 SMART
EGF_CA 1525 1565 2.13e-9 SMART
Pfam:TB 1585 1625 3.4e-15 PFAM
EGF_CA 1643 1684 6.74e-12 SMART
EGF_CA 1685 1726 1.06e-9 SMART
Pfam:TB 1741 1783 1.2e-17 PFAM
EGF_CA 1801 1842 7.34e-13 SMART
EGF_CA 1843 1884 4.15e-12 SMART
EGF_CA 1885 1926 5.23e-9 SMART
EGF_CA 1927 1965 5.87e-12 SMART
EGF_CA 1966 2008 1.11e-12 SMART
EGF_CA 2009 2048 1.26e-11 SMART
EGF_CA 2049 2090 7.12e-11 SMART
Pfam:TB 2105 2147 1.2e-15 PFAM
EGF_CA 2164 2205 2.89e-11 SMART
EGF_CA 2206 2245 1.1e-11 SMART
EGF_CA 2246 2286 3.76e-10 SMART
EGF_CA 2287 2330 1.44e-6 SMART
EGF_CA 2331 2372 1.16e-10 SMART
Pfam:TB 2387 2429 1.9e-16 PFAM
EGF_CA 2442 2483 8.43e-13 SMART
EGF_CA 2484 2524 4.96e-10 SMART
EGF_CA 2525 2563 7.63e-11 SMART
EGF_CA 2564 2606 6.44e-9 SMART
EGF_CA 2607 2646 2.28e-9 SMART
EGF_CA 2647 2687 1.79e-7 SMART
EGF_CA 2688 2727 3.45e-9 SMART
low complexity region 2774 2786 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 94.9%
  • 20x: 87.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of connective tissue microfibrils and may be involved in elastic fiber assembly. Mutations in this gene cause congenital contractural arachnodactyly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous, chemically-induced, and targeted null mutations show bilateral syndactyly with fusion of both soft and hard tissues. Deafness found in an X-ray induced allelic mutant is apparently due to the joint disruption of a linked gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik G A 17: 25,947,534 P343L probably benign Het
Acbd5 A T 2: 23,094,344 D294V probably damaging Het
Actn2 A T 13: 12,340,439 I21N probably benign Het
Adamts2 C A 11: 50,668,115 P219H possibly damaging Het
Atg16l2 A G 7: 101,289,906 F584L probably benign Het
Ccdc81 C T 7: 89,886,182 R282Q probably benign Het
Cd200r3 G A 16: 44,951,448 C25Y possibly damaging Het
Cdkl4 C T 17: 80,556,302 probably null Het
Chrne T C 11: 70,618,428 E109G possibly damaging Het
Clmp A G 9: 40,782,560 T358A probably benign Het
Cmtr1 G T 17: 29,687,047 probably null Het
Col25a1 A G 3: 130,550,050 E389G probably damaging Het
Ctc1 C T 11: 69,021,142 T49M probably damaging Het
Cyth3 T A 5: 143,701,372 M120K probably damaging Het
D430041D05Rik T A 2: 104,152,963 E1996V probably damaging Het
Dnah9 T C 11: 66,037,637 M2069V probably damaging Het
Dsg1c T C 18: 20,275,177 Y428H probably damaging Het
Exosc8 T A 3: 54,734,331 T7S probably damaging Het
F5 A G 1: 164,195,622 Y1583C probably damaging Het
Fam178b A G 1: 36,644,324 I105T probably damaging Het
Fam181a T A 12: 103,316,332 Y165* probably null Het
Fam212b G A 3: 105,716,820 G151D probably damaging Het
Gbgt1 A T 2: 28,504,976 M209L probably benign Het
Gkn2 C A 6: 87,378,170 Y120* probably null Het
Gm14295 T A 2: 176,807,364 D1E probably damaging Het
Gpr141 A T 13: 19,751,912 probably null Het
Gramd3 C A 18: 56,432,351 P26Q probably benign Het
Greb1 A G 12: 16,674,770 I1801T probably damaging Het
Gstm3 T A 3: 107,967,835 I64F possibly damaging Het
Gtse1 A G 15: 85,867,578 Y324C probably benign Het
Hal C G 10: 93,516,297 T650R probably benign Het
Hdac7 G A 15: 97,808,404 Q293* probably null Het
Hdlbp A T 1: 93,423,869 N437K probably damaging Het
Hif1an A G 19: 44,569,423 D248G probably damaging Het
Hivep3 T C 4: 120,095,704 S406P possibly damaging Het
Hmcn2 A T 2: 31,458,039 D4899V possibly damaging Het
Ikzf3 C T 11: 98,490,331 probably null Het
Itgb4 C A 11: 115,991,316 Y819* probably null Het
Itpripl1 T C 2: 127,141,635 D189G possibly damaging Het
Kmt2e A G 5: 23,482,502 Y450C probably damaging Het
Mc4r A G 18: 66,859,997 L15P probably benign Het
Mical1 T G 10: 41,481,393 probably null Het
Mical3 C T 6: 121,024,807 V575M probably damaging Het
Mki67 A T 7: 135,708,818 probably null Het
Mocs2 G A 13: 114,824,622 E52K probably benign Het
Myo7b T C 18: 32,000,051 N415S probably damaging Het
Notch1 G A 2: 26,478,612 T555I possibly damaging Het
Notch3 T C 17: 32,139,191 D1686G probably benign Het
Oit3 A G 10: 59,428,239 F358L probably damaging Het
Olfr417 A C 1: 174,368,949 I11L probably benign Het
Olfr424 A T 1: 174,137,317 D191V probably damaging Het
Orai1 T A 5: 123,029,202 I146N probably damaging Het
Pck1 A G 2: 173,154,718 I142V probably benign Het
Pdap1 C T 5: 145,132,929 V89M possibly damaging Het
Phf11a T C 14: 59,287,551 D68G possibly damaging Het
Pilrb2 T C 5: 137,871,248 N30S probably damaging Het
Pkd1 G A 17: 24,578,269 V2551I probably damaging Het
Pnpla7 T C 2: 25,052,599 V132A probably damaging Het
Rad18 C T 6: 112,628,519 S398N probably damaging Het
Rdh16f1 C A 10: 127,790,853 N258K probably benign Het
Riox2 A G 16: 59,483,042 H240R probably damaging Het
Ruvbl1 C T 6: 88,485,770 A292V probably damaging Het
Ryr1 C T 7: 29,095,490 G1151S probably damaging Het
Serpinb9b T C 13: 33,029,565 I35T possibly damaging Het
Slc1a1 T A 19: 28,904,722 M328K probably benign Het
Slc7a13 A T 4: 19,824,031 T267S possibly damaging Het
Speer3 G T 5: 13,796,321 M218I probably benign Het
Sptan1 A G 2: 29,986,420 I271V probably damaging Het
Swap70 A G 7: 110,264,048 T195A probably benign Het
Tgs1 T A 4: 3,585,964 N280K probably benign Het
Tonsl A G 15: 76,638,509 C181R probably damaging Het
Trdn A G 10: 33,258,102 K333R possibly damaging Het
Trpc4 T A 3: 54,299,179 M600K probably damaging Het
Ubr3 C T 2: 69,977,723 Q1183* probably null Het
Ubxn4 T A 1: 128,272,851 L360I possibly damaging Het
Ugt2b1 T A 5: 86,926,408 T31S probably benign Het
Uspl1 T C 5: 149,215,199 S1056P probably damaging Het
Vmn2r60 A T 7: 42,135,855 K164* probably null Het
Vwce T A 19: 10,646,744 L333* probably null Het
Wdr95 T A 5: 149,574,116 L253Q probably damaging Het
Wisp1 G T 15: 66,891,599 V12L possibly damaging Het
Zfp113 T C 5: 138,145,668 M107V probably benign Het
Zfp142 T C 1: 74,571,775 T851A possibly damaging Het
Other mutations in Fbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Fbn2 APN 18 58037809 missense possibly damaging 0.81
IGL00780:Fbn2 APN 18 58095988 missense probably damaging 1.00
IGL00923:Fbn2 APN 18 58012325 missense probably benign 0.00
IGL01011:Fbn2 APN 18 58095240 splice site probably benign
IGL01123:Fbn2 APN 18 58104081 missense possibly damaging 0.62
IGL01304:Fbn2 APN 18 58061745 missense probably damaging 0.97
IGL01339:Fbn2 APN 18 58113370 missense possibly damaging 0.75
IGL01465:Fbn2 APN 18 58203833 missense probably null 0.67
IGL01608:Fbn2 APN 18 58053704 nonsense probably null
IGL01682:Fbn2 APN 18 58072671 missense probably damaging 1.00
IGL01752:Fbn2 APN 18 58075977 splice site probably null
IGL01764:Fbn2 APN 18 58045351 missense probably damaging 1.00
IGL02002:Fbn2 APN 18 58114553 missense probably benign 0.01
IGL02010:Fbn2 APN 18 58037722 missense probably damaging 0.99
IGL02029:Fbn2 APN 18 58209603 missense probably benign 0.04
IGL02037:Fbn2 APN 18 58096015 missense probably damaging 1.00
IGL02350:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02357:Fbn2 APN 18 58103995 missense possibly damaging 0.71
IGL02653:Fbn2 APN 18 58076705 missense probably benign
IGL03233:Fbn2 APN 18 58102377 missense probably benign 0.39
IGL03347:Fbn2 APN 18 58013665 missense probably damaging 1.00
IGL03410:Fbn2 APN 18 58050243 missense possibly damaging 0.95
R0020:Fbn2 UTSW 18 58105164 missense probably damaging 1.00
R0069:Fbn2 UTSW 18 58069184 missense probably damaging 1.00
R0107:Fbn2 UTSW 18 58056203 missense probably benign 0.00
R0116:Fbn2 UTSW 18 58102373 nonsense probably null
R0277:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0284:Fbn2 UTSW 18 58050290 splice site probably benign
R0316:Fbn2 UTSW 18 58113325 missense probably damaging 1.00
R0323:Fbn2 UTSW 18 58045317 missense probably damaging 1.00
R0421:Fbn2 UTSW 18 58027804 splice site probably benign
R0455:Fbn2 UTSW 18 58035336 missense probably damaging 1.00
R0504:Fbn2 UTSW 18 58039460 missense possibly damaging 0.94
R0520:Fbn2 UTSW 18 58013749 missense probably damaging 1.00
R0632:Fbn2 UTSW 18 58037747 missense probably damaging 1.00
R0638:Fbn2 UTSW 18 58045374 missense probably damaging 0.98
R0645:Fbn2 UTSW 18 58058389 missense probably damaging 1.00
R1051:Fbn2 UTSW 18 58012353 missense probably damaging 0.99
R1209:Fbn2 UTSW 18 58070016 missense probably benign 0.00
R1319:Fbn2 UTSW 18 58200610 missense possibly damaging 0.88
R1400:Fbn2 UTSW 18 58080193 missense possibly damaging 0.90
R1437:Fbn2 UTSW 18 58053659 missense possibly damaging 0.68
R1463:Fbn2 UTSW 18 58010380 missense probably benign
R1612:Fbn2 UTSW 18 58061752 missense probably damaging 1.00
R1629:Fbn2 UTSW 18 58026538 missense probably damaging 1.00
R1639:Fbn2 UTSW 18 58058462 missense probably benign 0.41
R1722:Fbn2 UTSW 18 58048052 critical splice acceptor site probably null
R1749:Fbn2 UTSW 18 58050276 missense probably benign 0.35
R1802:Fbn2 UTSW 18 58052976 nonsense probably null
R1850:Fbn2 UTSW 18 58039305 splice site probably benign
R1913:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R2045:Fbn2 UTSW 18 58090658 missense probably damaging 1.00
R2064:Fbn2 UTSW 18 58048849 missense probably damaging 0.99
R2143:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2144:Fbn2 UTSW 18 58052993 missense possibly damaging 0.65
R2149:Fbn2 UTSW 18 58102325 splice site probably null
R2207:Fbn2 UTSW 18 58081399 nonsense probably null
R2219:Fbn2 UTSW 18 58052963 missense possibly damaging 0.79
R2263:Fbn2 UTSW 18 58095176 splice site probably benign
R2375:Fbn2 UTSW 18 58035966 missense probably damaging 1.00
R2424:Fbn2 UTSW 18 58203787 missense probably damaging 0.99
R2504:Fbn2 UTSW 18 58093359 missense probably damaging 0.99
R2879:Fbn2 UTSW 18 58069242 missense probably damaging 0.97
R3040:Fbn2 UTSW 18 58093387 missense probably damaging 1.00
R3080:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R3625:Fbn2 UTSW 18 58061742 missense probably damaging 1.00
R3901:Fbn2 UTSW 18 58066011 missense probably damaging 0.97
R4089:Fbn2 UTSW 18 58053769 missense probably benign 0.01
R4133:Fbn2 UTSW 18 58095962 missense possibly damaging 0.82
R4155:Fbn2 UTSW 18 58023287 nonsense probably null
R4288:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4289:Fbn2 UTSW 18 58035339 missense probably damaging 0.98
R4363:Fbn2 UTSW 18 58149050 missense probably damaging 0.97
R4559:Fbn2 UTSW 18 58076074 missense probably benign 0.00
R4601:Fbn2 UTSW 18 58053733 missense probably damaging 1.00
R4609:Fbn2 UTSW 18 58190269 nonsense probably null
R4626:Fbn2 UTSW 18 58013747 nonsense probably null
R4638:Fbn2 UTSW 18 58010304 missense probably benign 0.01
R4675:Fbn2 UTSW 18 58040193 missense possibly damaging 0.95
R4707:Fbn2 UTSW 18 58056272 missense probably damaging 1.00
R4758:Fbn2 UTSW 18 58026386 missense probably benign 0.00
R4945:Fbn2 UTSW 18 58050253 missense possibly damaging 0.53
R4955:Fbn2 UTSW 18 58058383 missense possibly damaging 0.61
R4980:Fbn2 UTSW 18 58010631 missense probably benign 0.05
R4998:Fbn2 UTSW 18 58072631 missense probably damaging 1.00
R5133:Fbn2 UTSW 18 58039340 missense probably damaging 0.99
R5322:Fbn2 UTSW 18 58039315 missense probably benign 0.00
R5414:Fbn2 UTSW 18 58093405 missense probably damaging 0.96
R5538:Fbn2 UTSW 18 58071901 missense probably benign 0.22
R5557:Fbn2 UTSW 18 58115659 missense probably benign 0.00
R5754:Fbn2 UTSW 18 58124311 missense probably benign 0.04
R5769:Fbn2 UTSW 18 58105199 missense probably damaging 1.00
R5790:Fbn2 UTSW 18 58076696 missense probably benign 0.34
R5830:Fbn2 UTSW 18 58114469 missense probably benign 0.01
R5845:Fbn2 UTSW 18 58053768 missense possibly damaging 0.89
R5880:Fbn2 UTSW 18 58023282 nonsense probably null
R5907:Fbn2 UTSW 18 58045337 missense probably damaging 1.00
R5948:Fbn2 UTSW 18 58037049 missense probably damaging 1.00
R5955:Fbn2 UTSW 18 58044256 missense probably damaging 1.00
R5974:Fbn2 UTSW 18 58048920 missense probably damaging 1.00
R6010:Fbn2 UTSW 18 58069524 missense probably benign 0.31
R6024:Fbn2 UTSW 18 58076836 missense probably benign 0.03
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6037:Fbn2 UTSW 18 58044223 missense probably benign 0.05
R6315:Fbn2 UTSW 18 58054953 critical splice acceptor site probably null
R6437:Fbn2 UTSW 18 58113363 missense probably damaging 1.00
R6519:Fbn2 UTSW 18 58063575 missense possibly damaging 0.61
R6520:Fbn2 UTSW 18 58102390 missense probably damaging 1.00
R6734:Fbn2 UTSW 18 58035960 missense probably damaging 1.00
R6755:Fbn2 UTSW 18 58113333 missense possibly damaging 0.89
R6789:Fbn2 UTSW 18 58010614 missense probably benign 0.00
R6801:Fbn2 UTSW 18 58113348 missense probably benign 0.04
R6862:Fbn2 UTSW 18 58124321 missense probably benign 0.04
R6900:Fbn2 UTSW 18 58076831 missense probably benign
R6906:Fbn2 UTSW 18 58071819 missense possibly damaging 0.94
R6919:Fbn2 UTSW 18 58124187 intron probably null
R6950:Fbn2 UTSW 18 58035921 missense probably null 0.21
R6985:Fbn2 UTSW 18 58068388 missense probably damaging 1.00
X0062:Fbn2 UTSW 18 58056213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTTCAAGAACCCAGTGCC -3'
(R):5'- AGCTGAGGACATGAATGTGACCCC -3'

Sequencing Primer
(F):5'- GTTGACTGGGACCTCAAAGATTC -3'
(R):5'- TGAATGTGACCCCCCACC -3'
Posted On2014-04-24